Praca oryginalna Original paper
Regulation of water, mineral, sugar, fat, and protein of mammals is dependent on the glucocorticoid and mineralocorticoid. These hormones acquire their character and properties due to hydroxylation in the position of C21, catalyzed by a key enzyme of adrenal steroidogenesis steroid 21-hydroxylase (21HS, CYP21) (8, 24). It performs the conversion of pro-gesterone and its derivative, 17-hydroxypropro-gesterone, to metabolites such as 11-deoxycorticosterone and 11-deoxycortisol and leads to the synthesis of the main adrenal hormones: cortisol, corticosterone, and aldo-sterone (14, 13). As a result of mutations in the gene 21HS (Cyp21), there is often a deficiency of 21HS, which causes the inhibition of glucocorticoid and mineralocorticoid synthesis (1, 21, 26). This disrupts
the feedback mechanism between cortisol and adreno-corticotropic hormone (ACTH). Low levels of cortisol triggers a response that leads to increased secretion of ACTH by the pituitary gland. The result is an incre-ased synthesis of progesterone and 17-hydroxypro-gesterone. These compounds, due to lack of 21HS, cannot be transformed into 11-deoxycorticosterone, and 11-deoxycortisol joins the alternative pathway of androgens synthesis, which results in a systemic hyper-androgenism (19, 20, 27). These disorders are mani-fested in congenital adrenal hyperplasia (CAH). In cats, to date CAH describes the only reasons for CYP11 enzyme deficiency (11, 18). Thus, the genetic causes of CAH spectrum has not yet been determined. Genetic research should therefore start by setting the basic
Molecular phylogenetic analysis of the domestic cat
and the Eurasian lynx based on the Cyp21 gene
BARBARA KOSOWSKA, TOMASZ STRZA£A, KATARZYNA BRZEZIÑSKA, KRZYSZTOF GRABOWSKI, TADEUSZ DOBOSZ*, ARLETA LEBIODA*
Laboratory for Molecular Cell Biology, Department of Genetics, Faculty of Biology and Animal Breeding, Wroc³aw University of Environmental and Life Sciences, ul. Ko¿uchowska 7, 51-631 Wroc³aw, Poland
*Molecular Techniques Unit, Department of Forensic Medicine, Faculty of Medicine, Wroc³aw Medical University, ul. M. Curie-Sk³odowskiej 52, 50-369 Wroc³aw, Poland
Kosowska B., Strza³a T., Brzeziñska K., Grabowski K., Dobosz T., Lebioda A.
Molecular phylogenetic analysis of the domestic cat and the Eurasian lynx based on the Cyp21 gene
Summmary
The aim of the study was to determine the nucleotide sequence of the CYP21 gene of the Eurasian lynx, eight representatives of five selected domestic cat breeds and a European mixed-breed cat on account of the key role of this gene product in adrenal steroidogenesis. Cats nuclear DNA was obtained from peripheral blood, while the lynx DNA was isolated from muscle tissue. 21HS gene amplification was performed in 10 parts with the unified PCR conditions. The reaction products were sequenced. On the basis of the determined nucleotide (nc) sequence of the gene, the sequence of amino acids (aa) of the protein was determined. The sequences obtained in our study and collected from the GeneBank were aligned using Mafft and subjected to phylogenetic analysis using the program MrBayes 3.2. A total of 11 SNPs were detected in 9 tested cat breeds and an additional 3 indels in the mixed-breed cat. Between the studied cats and lynx a total of 33 SNP differences were determined. In addition, three indels were located in the lynx that were absent in cats. In domestic cats the 21HS gene occurs as a series of three long alleles: 2500 bp, 2503 bp, and 2504 bp. Both alleles of lynx were 2502 bp in length. Genetic distance was identified between the studied breeds of cats, as well as between cats and the lynx. A genetic analysis of Cyp21 nucleotide sequences of cats and lynx was performed against homologous sequences obtained from GeneBank, derived from 13 different vertebrate species. In addition, evolutionary distance was estimated between the amino acid sequences (aa) of the cat/lynx and homologous sequences obtained from the GeneBank and derived from 15 different vertebrate species. It was demonstrated that the aa sequence of cat is almost identical to the sequence of lynx. Overall, basing on 21HS aa sequence, the closest kinship links felines and canids, then felines with pigs and ruminants, after which were rodents. The lowest CYP21 kinship links aa sequences of felines with eels and birds, followed by humans and apes.
sequence of the key steroidogenic gene the 21HS locus. Knowing the sequence of a gene enables several important objectives of research to be achieved. In addition to diagnostics and facilitating treatment, the knowledge enables the realization of phylogenetic and evolutionary research, very helpful in determining the relatedness of organisms and species. Currently, there are no works devoted to the anatomy of the feline Cyp21 gene, the variation of its locus, the means of its evolution, and mutations that occur in the population. Thus, to fill the remaining gaps in this area, the pre-sent study was undertaken in order to:
determine the nucleotide and amino acid sequences of 21HS of previously not studied species: the dome-stic cat and closely related to the cat lynx;
perform a detailed analysis of Cyp21 gene of selected cat breeds and the lynx in comparison to other vertebrate species, the gene sequences of which are currently available in GenBank;
do phylogenetic analysis of known gene sequences of feline 21HS in comparison to other known verte-brate Cyp21 locus sequences deposited in databases.
Material and methods
To research selected breeds of domestic cat (Felis catus) of significantly different phenotype, one representative was selected from the breeds: Maine Coon, Chartreux, Exotic Shorthair, Birman, 4 representatives of the Persian breed, and one mixed-breed cat, subsequently referred to as the European cat. The larger number of Persian cats was due to the great popularity of this breed in Poland. None of the animals showed any symptoms of illness. Samples from the Eurasian lynx (Lynx lynx) were obtained from the Mammal Research Institute, Polish Academy of Sciences (samples were collected from animals killed in road acci-dents). Cat DNA was extracted from peripheral blood using a QIAamp DNA Blood Mini Kit (Qiagen). DNA isolation from lynx muscle tissue was performed using Sherlock AX kit (A&A Biotechnology). Qualitative and quantitative evaluation of isolates was performed through electropho-resis in 1% agarose gel. CYP21 gene amplification was performed in 10 fragments. PCR thermal conditions: 95°C 2 min, (95°C 1 min, 60°C 1 min, 72°C 1 min) × 30 cycles, 72°C 10 min. The reaction was performed in a volume of 25 µl using the following components: buffer: 2.5 µl, glycerol: 2.5 µl/Q-Solution: 5.0 µl, dNTP mix: 0.4 µl, primers (concentration 25 pmol/µl): 0.5 µl of each, Taq polymerase (5 U/µl): 0.2 µl, genomic DNA solution (concentration 30 ng/µl): 1 µl, water: up to 25 µl.
The following primer sequences were designed using Primer 3 software (23) and used for amplification (F = for-ward, R = reverse, length of overlapped amplified fragments showed in parentheses): 1. (556 bp) F 5 cccttcctttcttcttgatg 3 R 5 tgaccatggcttcctcgatg 3 2. (452 bp) F 5 ctgcaaggtgagtctgcttc 3 R 5 ctcacctcacagaactcctg 3 3. (401 bp) F 5 tgctgtggaaggctcacaag 3 R 5 gtactaaggtgtcctcctgc 3 4. (407 bp) F 5 catctgttgcctcaccttcg 3 R 5 ctgcctcagctgcttctcta 3 5. (336 bp) F 5 ttccctttctcagggtgagg 3 R 5 tagtcggtcatgtccctcca 3 6. (560 bp) F 5 tagagaagcagctgaggcag 3 R 5 tgcagtcgctgctgaatctg 3 7. (495 bp) F 5 ggaccttttcattggcggca 3 R 5 gctcttaggagagtcacctg 3 8. (467 bp) F 5 aggagctggactgtgaactg 3 R 5 tgggaccaggaaacgatctg 3 9. (482 bp) F 5 cacttagacgagacggtctg 3 R 5 acggggtttgtacgggagaa 3 10. (358 bp) F 5 ctcagcatgcagcctttcca 3 R 5 gcccttcacggaaatgaagc 3
After amplification PCR products were purified using a GenElute PCR Clean-Up Kit (Sigma) and then both strands were sequenced. The resulting fragments were aligned using the program BioEdit v.7.0.0 (6) and on the basis of this alignment consensus sequences were establi-shed. A 21HS phylogenetic tree was generated using a set sequence of cats and lynx from our study and the sequence of a wolf obtained from Genbank (DQ336566) and used for rooting the tree. Sequences were aligned using Mafft program (10) and the tree was constructed with MrBayes (22), using the HKY substitution model suggested by the program MrAIC (16). 10 million MCMC repeats were made and a burn-in value equal to 25% of all trees. Basing on the known nucleotide sequence of canine 21-HS, the position of introns and exons in cats and lynx gene was determined. On this basis, the amino acid (aa) sequence in 21HS of cats and lynx was determined. Using the program T-Coffee (15), feline aa sequences of 21HS was aligned with other homo-logous sequences from GeneBank. To investigate the phylo-genetic status of feline aa sequences compared to other animals, a phylogenetic tree was created. In addition to cats and lynx the tree consisted of GeneBank sequences obtained from: domestic dog [BAB79541.1], gray wolf [ABC67289], human [AAB59440.1], cattle [AAA83247.1], domestic pig [AAM11646.1], house mouse [AAA37114.1], brown rat [AAD05573.1], Chinese hamster [EGV95259], naked mole rat [EHB16088], Chacma baboon [ABY57765], rhesus macaque [NP_001181556], golden pheasant [AFN53625], chicken [BAJ53029], Japanese eel [BAC76051.1] and domestic sheep from the PIR database http://pir.georgetown.edu/ [A43349]. Dendrogram was generated using the program MrBayes (22) with the JTT + G model suggested by the application ProtTest 3.0 (6). 10 million MCMS repeat were used with 25% burn-in value.
Results and discussion
Cyp21 gene was sequenced in 10 representatives of Felinae, the 21HS gene sequence of the Eurasian lynx, four full sequences from the Persian breed and one complete sequence from each breed: Maine Coon, Chartreux, Birman and Exotic Shorthair. The coding part of the gene consist of ten exons in all tested feli-nes, the exons are separated by 9 introns. The open reading frame of cat and lynx contains of 1479 bp. The alleles length of a mixed-breed cat (without known
origin) could not be determined with 100% certainty, due to the presence of 3 indels in various introns. Table 1 shows the length polymorphism of the gene sequence of all tested felines except the European cat. The results summarized in Table 1 indicate that the 21HS feline gene occurs in a series of four alleles of different lengths (2500, 2502, 2503, 2504 bp). Among eight tested pedigree cats, three
allele length were detected (2500 pz, 2503 pz, 2504) with the frequencies: 0.062. 0.625 and 0.312, respectively. The shortest allele (2500 space bp) was described only in Main Coon, the difference between the alleles was caused by a three bp deletion in the fifth intron. The allele length of the European cat could not be definitively deter-mined, because of indels occur-ring in different introns of the two variants of the gene. Lynx proved to be homozygous in allele length (2502 bp). The lynx gene sequence was different from the sequence of the three cats in indels located in introns 5, 6 and 8, which did not occur in cats. Indels located in introns had no effect on the phenotype of the protein, but only on the length of the gene.
Table 2 summarizes detected SNP mutations in the 21HS gene of the studied felids and fre-quencies of particular alleles. The total SNP variation of the Cyp21 gene sequence of the studied felines involved 44 loci. In 11 of them differences were described only in Felis catus. Only BIRM and P3 cats have completely homozygous sequen-ces. In the group of four Persians, the sequences of two of them (2, 4) were identical. Among five SNPs identified in Persian cats, 2 involved exons 3 and 5, and 3 were found in the sixth intron. A detailed analysis of 2503 bp allele sequences showed that they are not identical. 2503 bp
allele present in Chartreux had a single SNP change in intron 7, which is absent in alleles of the same length present in the Maine Coon, Exotic Shorthair and Persian breeds. Apart from this, due to SNP mutation in introns 6 and 9 the allele of 2504 bp sequenced in the Birman cat differed from alleles of the same length present in the Chartreux and Persians. The most heterozygous individual was a European cat, in which the length of the two variants of the gene were not established. Detailed analysis of the sequence of both
n a m ri B Charrteux ShEoxotrhitacri MCaoionne Persian1 Persian2 Persian3 Persian4 Eulryansxian 4 0 5 2 2504 3 0 5 2 2503 22550003 2503 22550034 2503 22550034 2502
Tab. 1. Allele length (bp) of the Cyp21 gene in studied pedigree cats and lynx
n o it u ti t s b u S n o it a c o l pos. alleles codon cloedttoern aa individual niunmd.b. rfeqaulleenlecies r e t o m o r P e c n e u q e s 89 GA//AG REMALINING 91 AG00,,91 r e t o m o r P e c n e u q e s 67 TC//TC REMALINING 91 TC00,,91 r e t o m o r P e c n e u q e s 66 GA//GA REMALINING 91 GA00,,91 r e t o m o r P e c n e u q e s 60 GT//TG REMALINING 91 GT00,,91 1 n o s k E 33 GA//AG 11 GGCCGA AAllaa REMALINING 91 AG00,,91 1 n o s k E 36 GA//GA 12 CCTTGA LLeeuu REMALINING 91 GA00,,91 2 n o s k E 306 AG//GG 74 AAAAA/AGAG LLyyss REMEAUINING 19 AG00,,0955 2 n o s k E 325 CA//AC 81 CATTGG MLeeut REMALINING 19 CA00,,91 2 n o s k E 342 GA//AG 86 GGTTAG VVaall REMALINING 91 AG00,,91 2 n o rt n I 409 GT//TG REMALINING 91 GT00,,91 2 n o rt n I 423 GA//GA REMALINING 91 GA00,,91 3 n o s k E 495 AC//AC 103 CCACCC HPrios REMALINING 91 AR00,,91 3 n o s k E 558 AG//GG 124 CACCG/CCGC HiAs/rAgrg REEUM,API2N,INP4G 37 AG00,,1855 4 n o s k E 807 CT//TC 177 TTTTCT PPhhee REMALINING 91 CT00,,91 4 n o rt n I 898 GA//AG REMALINING 91 AG00,,91 5 n o s k E 957 CT//TT C / C 189 T A C / C A C T A C C A C s i H s i H s i H 4 P , 2 P , H C L , M R I B G N I N I A M E R 3 2 5 5 6 , 0 C 5 3 , 0 T 5 n o s k E 967 GC//GC 193 GCAAAA GGllnu REMALINING 91 GC00,,91 5 n o rt n I 1057 CT//TC REMALINING 91 CT00,,91 5 n o rt n I 1091 CT//TC REMALINING 91 CT00,,91 5 n o rt n I 1120 CT//TC REMALINING 91 CT00,,91
Tab. 2. Location and frequencies of the SNP mutations in the 21HS locus, occurring in 9 cats of 6 breeds and in a Eurasian lynx
alleles of this cat showed that they are not identical with any of the other alleles detected in cats tested in this study. In ad-dition to characteristic changes in the introns, exons 2 and 10 also had SNPs specific only for European cat. Total 33 SNP dif-ferences were found between lynx and domestic cats, 4 were located in the promoter region, 15 in introns, 12 in exons and 2 in the 3UTR sequence. These differences reflected genetic distance: the smallest among individuals of one breed, larger between breeds, and the largest among species.
Length variability of the Cyp21 gene nucleotide sequence in different vertebrates ranged from 2460 bp (dog, wolf) to 3843 bp (chicken). The sequen-ce of chickens was longer than sequences of predators by about 36%. Feline gene length was closest to that of the pig and Canidae. The shortest exons were described in pheasant 1413 bp, the longest in the eel 1572 bp. Length of exons in four species of carnivora (fe-line and canine) were identical. Exon sequence variability was insignificant in the compared species, ranged from 0% to 3%. In comparison with other spe-cies, feline exons had an average length. Variation of the introns length in the tested species included an area about 2 times larger than exons. Length of introns ranged from 981 bp (canines) to 2409 bp (chicken). This difference reached 60%. The variability coefficient of the introns length ranged between 5% and 62% in the tested species. The lengths of feline introns were most similar to canines: the similarity ranged from 81% (between a cat and a wolf and a dog), to 98% between the lynx and the cat, and up to 100% between a wolf and a dog. Variability in the length of introns was increased by most diverse sequences of
n o it u ti t s b u S n o it a c o l pos. alleles codon cloedtteorn aa individual niunmd.b. rfeqaulleenlecies 6 n o s k E 1152 GA//GA 222 CCGAGG GArlgn REMALINING 91 CT00,,91 6 n o rt n I 1249 AA//CA C / C , C M , Z G E , H C 1 P , 4 P , 2 P L , U E , M R I B 3 P 6 3 1 6 , 0 A 4 , 0 C 6 n o rt n I 1350 CC//TC T / T , C M , U E , H C 4 P , 2 P M R I B R , 3 P , 1 P , Z G E 5 1 4 5 3 , 0 C 5 6 , 0 T 6 n o rt n I 1359 CT//TT REEMGZA,INPIN1G 28 CT00,,91 7 n o s k E 1439 AG//AG 266 AAAGAA ALyrgs REMALINING 91 CT00,,91 7 n o s k E 1442 TC//TC 267 GGTCGG VAlaal REMALINING 91 CT00,,91 7 n o rt n I 1590 TC//TC REMALINING 91 CT00,,91 7 n o rt n I 1592 CT//CT REMALINING 91 CT-00,,19 7 n o rt n I 1597 GG//GA REMCAHINING 91 GA00,,19 7 n o rt n I 1620 GA//GA REMALINING 91 CT00,,91 7 n o rt n I 1627 CT//CT REMALINING 91 CT00,,91 7 n o rt n I 1683 AG//AG REMALINING 91 CT00,,91 7 n o rt n I 1784 TC//TC REMALINING 91 CT00,,91 8 n o s k E 1901 TC//TC 348 GGCCTC AAllaa REMALINING 91 CT00,,91 8 n o rt n I 1975 CT//CT REMALINING 91 CT00,,91 8 n o rt n I 2035 CT//CT REMALINING 91 CT00,,91 9 n o rt n I 2166 CC//CG REMEAUINING 91 GC00,,91 9 n o rt n I 2210 GA//GA REMALINING 91 CT00,,91 9 n o rt n I 2227 AT//AT REMBIARIMNING 91 AT00,,91 0 1 n o s k E 2370 CC//TC 449 CTCGT/TGTG Leu REMEAUINING 91 TC00,,19 0 1 n o s k E 2455 GA//GA 477 CCGAGG GArlgn REMALINING 91 CT00,,91 0 1 n o s k E 2456 GG//GT 477 CGCGG/CGGT Arg REMEAUINING 91 GT00,,19 R T U ' 3 22552201 CT//CT REMALINING 91 CT00,,91 R T U ' 3 22554401 AT//AT REMALINING 91 CT00,,91
Explanations: pos. position, aa encoded amino acid, ind. numb. number of individuals with a particular genotype, BIRM Birman, CH Chartreux, EGZ Exotic Shorthair, EU European cat, MC Maine Coon, P1-P4 Persians, L Eurasian lynx
Fig. 1. Phylogenetic tree of 10 nucleotide sequences of the steroid 21-hydroxylase gene. Tree was rooted with the sequence of a wolf
3 species: mouse, human and cattle. The highest variation was observed in intron 2 (62%), 3 (41%) and 7 (41%). Within these three species, generally the smallest intron sequence similarity was found: between cattle and mouse was only 56%, between man and mouse 58%, and between man and cattle 67%. Nuc-leotide sequence data was the basis to generate a Cyp21 gene tree of felines.
Figure 1 shows a phylogenetic tree created from the alignment of 10 21HS nucleotide sequences: lynx, 8 cats, and a mixed-breed cat called European. Bran-ches of the tree represent the most likely genetic distance estimates based on differences in the 21HS gene sequence of felines. Nodes probability in the tree reflect the significance of clades arrangement (sequence data). The oldest evolutionary branch of the tree is a lynx clade connected by a highly significant node with other cats. Next to lynx the branch created exclusively from the Birman sequence was located. Another separate clade, distinguished from the Birman branch and consisting of eight other early evolutionary
Tab. 3. Allele lengths of Cyp21 gene and the total length of the exons and introns in domestic cats and a Eurasian lynx against Cyp21 gene sequences of other vertebrate species obtained from databases (access codes in brackets) e c r u o s e c n e u q e s d n a s e i c e p S Gene(bple)ngth Tleontaglthex(obnp)s Tloetnagltihn(rtbopn)s ) 9 2 4 1 4 3 Q D ( t a c c it s e m o D 2500-2504 1479 1021-1025 ) 0 3 4 1 4 3 Q D ( x n y l n a i s a r u E 2502 1479 1023 ) 6 6 5 6 3 3 Q D ( g o d c it s e m o D 2460 1479 1981 ) 6 6 5 6 3 3 Q D ( fl o w y e r G 2460 1479 1981 ) 0 1 4 0 9 4 F A ( e n i w s c it s e m o D 2537 1478 1059 ) 9 0 0 5 1 M ( e s u o m e s u o H 2633 1461 1172 ) 3 5 8 6 5 U N R ( t a r y e r G 1482 ) 9 4 3 3 4 A ( p e e h s c it s e m o D 1494 ) 7 6 2 1 1 M ( e lt t a c c it s e m o D 2922 1491 1431 ) 2 9 7 2 1 M ( s n e i p a s o m o H 2706 1485 1221 ) 7 2 6 4 9 1 1 0 0 _ M N a tt a l u m a c a c a M 1488 ) 7 1 4 2 4 3 U E ( n o o b a b a m c a h C 1487 ) 1 3 5 1 1 0 P A ( n e k c i h c c it s e m o D 3843 1434 2409 ) 6 6 3 0 4 4 Q J ( t n a s a e h p n e d l o G 3771 1413 2358 ) 1 1 1 5 9 0 B A ( l e e e s e n a p a J 1572
feline sequences located most to the right, were the groups of sequences of pedigree cats and the European cat. How-ever, because the node has no significant value, the detailed sequence relatedness structure of mixed-breed and pedigree cats may be different. Figure 2 shows the phylogenetic tree derived from aa sequences of 21HS of lynx, cat, and 15 species of vertebrates. These sequences were chosen for the analysis because of they have greater adaptive value then nucleotide sequences. This is because selection pressure is exerted directly on the sequence of the protein. Between the examined sequences of cat and lynx (con-sisting of 492 aa residues) 7 differences were found. The tree was rooted with the sequence of the Japanese eel. Sequence homology between mammals and eel was 39-43%, and 70-85% between mammals. All nodes in the tree were significant. The clade closest to the tree root consisted of two aa 21HS sequences of birds the evolutionary older pheasant and younger chicken. Next to the birds clade was a branch that consisted of human and other primates sequences. The following node joined two clades one included rodents (the oldest naked mole rat and then hamster, mouse and rat). The other was split into two groups of sequences: first porcine linked with ruminants, and second carnivores with the evo-lutionary older felinae and younger canidae. Overall,
Fig. 2. Phylogenetic tree based on amino acid sequences of the steroid 21-hydroxylase of cat/lynx, and 14 species of vertebrates basing on the 21HS aa sequence, the closest
relation-ship links felinae of canidae, then the pig and rumi-nants, after which rodents with all previous species. The lowest degree of kinship connects sequences of eel and felines, birds and then humans and apes.
Information obtained in the study of potential racial specificity of certain polymorphisms in the 21HS nucleotide allele sequences, in addition to those already described (12, 17), may facilitate the identification of the breed, the more so that breed barriers in cats are poorly marked (7, 12). The results of phylogenetic analysis performed based on the 21HS gene sequence of nine cats from 5 breeds, are consistent with the results of important works carried out that were based on many SNPs, STR, and mtDNA sequences, investi-gating the origin of cat breeds and the genetic distance between them (17). In the present study, based on the 21HS nucleotide sequence, it was showed that the Birman sequence and sequences of other cat breeds split the largest genetic distance, which is consistent with the results of the studies cited above. The other breeds were put in the same clade, which reflects the similarity of gene sequences having their source in the closer kinship of the four remaining breeds.
Contemporary living cats, classified as a Felinae subfamily, split from a common ancestor about 11 million years ago. The separation of the lynx line was more than 7 million years ago, while the domestic cat about 6 million years ago (2). Both the lynx as well as the domestic cat as a species count about one million years (9). The total 21HS gene sequence of lynx (2502 bp), is located in a length range including 3 alleles of domestic cat. The open reading frame of both cat and lynx has the same number of nucleotides 1479. Comparing these data on domestic cat and lynx, and knowing that the sequence of the lynx is evolutio-narily older (9), it was assumed that the Cyp21 gene sequences of both species may be identical. However,
detailed analysis of sequence polymorphisms within the cat and lynx ruled out this thesis. Between the cat and the lynx sequences 36 differences were finally determined: 33 of them were substitutions, and 3 were indels located in the introns.
The sequencing results provide a great deal of information about the structure of the 21HS gene in vertebrates. During the analysis the existence of large differences in the sequence and length of introns was demonstrated in the compared taxa.
Many researchers consider alignments of aa sequ-ences to be the most suitable in phylogenetic studies (4, 5, 25), because they are directly subordinate to natural selection and determine the main direction of evolution. According to this view, the analysis of the Cyp21 locus of felines against other homologous vertebrate sequences obtained from the databases used aa sequences. Aa sequences tree topology of 21HS corresponds to the main assumptions of Cornelis work
(5) devoted to classical phylogeny. Aa tree branches showed that the felines are evolutionarily older than canids, sheep from the cattle, and the mouse from the rat, which is also consistent with the results of other authors (3, 29). It is known that the gene tree does not always reflect the phylogenetic tree of the species. However analysis of the homologous sequence evolu-tion is usually consistent with the generally accepted phylogeny (5, 28). In the present study, 21HS aa sequence comparison diversified human primates and monkeys differently than classical phylogeny indicates. The number of changes in human 21HS aa sequence turned out to be lower than in baboons and macaques, such artifacts can be affected by many factors, inclu-ding the number of events that affect the evolution of the gene. Aa sequence variability is lower than the nucleotide or intron sequence. However, using intron sequences in this particular case would reflect a turbu-lent history of hypervariable Cyp21 gene introns (espe-cially in species with two copies of the Cyp21 gene), which could disrupt the comparisons and result in erroneous conclusions.
In summary, the genetic and phylogenetic analysis performed on the basis of aa sequence and gene Cyp21 sequences, greatly expands knowledge of the sequence of 21HS gene and protein, not only in felines, but also in other vertebrates. A further increase of knowledge about the locus Cyp21 requires additional detailed study.
References
1.Barg E., Tokarska M., Wikiera B., Kosowska B.: Congenital Adrenal Hyper-plasia Advances in Diagnosis. Adv. Clin. Exp. Med. 2003, 12, 507-515. 2.Benton M. J.: Early origins of modern birds and mammals: molecules vs.
morphology. Bioessays 1999, 21, 1043-1051.
3.Bromham L., Phillips M. J., Penny D.: Growing up with dinosaurs: molecular dates and the mammalian radiation. Trends Ecol. Evol. 1999, 14, 113-118. 4.Cavalli-Sforza L. L.: The DNA revolution in population genetics. Trends
Genet. 1998, 14, 60-65.
5.Corneli P. S.: Complete Mitochondrial Genomes and Eutherian Evolution. J. Mammal. Evol. 2002, 9, 281-305.
6.Darriba D., Taboada G. L., Doallo R., Posada D.: ProtTest 3: fast selection of best-fit models of protein evolution. Bioinformatics 2011, 27, 1164-1165. 7.Driscoll C. A., Menotti-Raymond M., Roca A. L., Hupe K., Johnson W. E, Geffen E., Harley E. H., Delibes M., Pontier D., Kitchener A. C., Yama-guchi N., OBrien S. J., Macdonald D. W.: The Near Eastern Origin of Cat Domestication. Science 2007, 317, 519-523.
8.Forest M. G.: Steroid enzyme defects leading to male pseudohermaphrodi-tism. Indian J. Pediatr. 1992, 59, 501-514.
9.Johnson W. E., Eizirik E., Pecon-Slattery J., Murphy W. J., Antunes A., Teeling E., OBrien S. J.: The late Miocene radiation of modern Felidae: a genetic assessment. Science 2006, 311, 73-77.
10.Katoh K., Toh H.: Parallelization of the MAFFT multiple sequence align-ment program. Bioinformatics 2010, 26, 1899-1900.
11.Knighton E. L.: Congenital adrenal hyperplasia secondary to 11 beta-hydro-xylase deficiency in a domestic cat. J. Am. Vet. Med. Assoc. 2004, 225, 238--241.
12.Menotti-Raymond M., David V. A., Pflueger S. M., Lindblad-Toh K., Wade C. M., OBrien S. J., Johnson W. E.: Patterns of molecular genetic variation among cat breeds. Genomics 2008, 91, 1-11.
13.Merke D. P.: Approach to the Adult with Congenital Adrenal Hyperplasia due to 21-Hydroxylase Deficiency. J. Clin. Endocrinol. Metab. 2008, 93, 653-660.
14.Nebert D. W., Russell D. W.: Clinical importance of the cytochromes P450. Lancet 2002, 360, 1155-6112.
15.Notredame C., Higgins D. G., Heringa J.: T-Coffee: A novel method for fast and accurate multiple sequence alignment. J. Mol. Biol. 2000, 302, 205-217.
16.Nylander J.: MrModeltest v2. Program distributed by the author. Evolutio-nary Biology Centre, Uppsala University 2004.
17.OBrien S. J., Johnson W., Driscoll C., Pontius J., Pecon-Slattery J., Menotti--Raymond M.: State of cat genomics. Trends. Genet. 2008, 24, 268-279. 18.Owens S. L., Downey M. E., Pressler B. M., Birkenheuer A. J., Chandler D. W.,
Scott-Moncrieff J. C.: Congenital Adrenal Hyperplasia Associated with Mutation in an 11â-Hydroxylase-Like Gene in a Cat. J. Vet. Intern. Med. 2012, 26, 1221-1226.
19.Pang S., Yang X., Wang M., Tissot R., Nino M., Manaligod J., Bullock L. P., Mason J. I.: Inherited congenital adrenal hyperplasia in the rabbit: absent cholesterol side-chain cleavage cytochrome P450 gene expression. Endo-crinology 1992, 31, 181-186.
20.Puts D. A., McDaniel M. A., Jordan C. L., Breedlove S. M.: Spatial Ability and Prenatal Androgens: Meta-analyses of CAH and Digit Ratio (2D:4D) Studies. Arch. Sex. Behav. 2008, 37, 100-111.
21.Riepe F. G., Sippell W. G.: Recent advances in diagnosis, treatment, and outcome of congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Rev. Endocr. Metab. Disord. 2007, 8, 349-363.
22.Ronquist F., Huelsenbeck J. P.: MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572-1574.
23.Rozen S., Skaletsky H. J.: Primer 3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 2000, 132, 365-386.
24.Speiser P. W., Azziz R., Baskin L. S., Ghizzoni L., Hensle T. W., Merke D. P., Meyer-Bahlburg H. F., Miller W. L., Montori V. M., Oberfield S. E., Ritzen M., White P. C.: Endocrine Society: Congenital Adrenal Hyperplasia Due to Steroid 21-Hydroxylase Deficiency: An Endocrine Society Clinical Practice Guideline. J. Clin. Endocrinol. Metab. 2010, 95, 4133-4160.
25.Strza³a T., Frontczak A., Plizga A., Kosowska B.: Analiza filogenetyczna genu 21-hydroksylazy steroidowej u przedstawicieli gromady Mammalia. Zeszyty Naukowe Akademii Rolniczej we Wroc³awiu 2004, 501, 311-318. 26.White P. C., Speiser P. W.: Congenital adrenal hyperplasia due to
21-hydro-xylase deficiency. Endocr. Rev. 2000, 21, 245-291.
27.Wisniewski A. B., Migeon C. J., Malouf M. A., Gearhart J. P.: Psychosexual Outcome In Women Affected By Congenital Adrenal Hyperplasia Due To 21-Hydroxylase Deficiency J. Urol. 2004, 171, 2497-2501.
28.Yoder A. D., Yang Z.: Estimation of primate speciation dates using local molecular clocks. Mol. Biol. Evol. 2000, 17, 1081-1090.
29.Zardoya R., Meyer A.: Phylogenetic performance of mitochondrial protein--coding genes in resolving relationships among vertebrates. Mol. Biol. Evol. 1996, 13, 933-942.
Corresponding author: prof. dr hab. Barbara Kosowska, Department of Genetics, Wroc³aw University of Environmental and Life Sciences, ul. Ko¿uchowska 7, 51-631 Wroc³aw
