Praca oryginalna Original paper
Making good alfalfa silage is troublesome because alkaline products of protein degradation neutralise organic acids during the ensiling process. In order to improve the course of fermentation, it seems appro-priate to add preparations which facilitate ensiling, e.g. additives that contain in their composition propionic and formic acids (16). When feeding animals Lucerne silages, it is important to remember that they contain biogenic amines: among others, tryptamine, spermine, spermidine, histamine, tyramine, putrescine and cada-verine. These compounds are present in plant cells either in free form or in a combination with phenolic compounds and can also be found in animal cells (4). Biogenic amines occurring in plant and animal orga-nisms can affect protein synthesis, DNA replication, permeability of cell membranes, and can participate in the regulation of lactation and also exert a carcino-genic effect (10). Biocarcino-genic amines are also found in silages and their concentration depends on the process of microbiological decarbonization of amino acids. The level of amine concentrations is mainly the result of the action of lactic fermentation bacteria and
Entero-bacteriaceae which manufacture enzymes capable of decarbonization of precursors of appropriate amines (7). The objective of the performed investigations was to determine the method of conservation of alfalfa (Medicago media Pers.) forage (wilting and addition of a chemical preparation) on the level of selected biogenic amines, total counts of Enterobacteriaceae and lactic acid bacteria with special emphasis on Lactoba-cillus plantarum, LactobaLactoba-cillus brevis, LactobaLactoba-cillus buchneri as the most frequent and numerous groups occurring in silages.
Material and methods
The employed plant material comprised hybrid Lucerne (Medicago media Pers.) cv. RADIUS derived from Bart¹¿ek Plant Breeding Station. Alfalfa was harvested from the first cut at budding stage. Part of the forage was wilted for 8 hours. Prior to ensiling, plant material was cut into chaff of 3 cm length. Experimental silages were prepared in laboratory PVC microsilos (n = 30) of 4 dm3 volume
equip-ped in a lid allowing release of gaseous products. Silages were prepared in the following three combinations: FS
Effects of the method of alfalfa ensiling
on the content of biogenic amines
and numbers of some strains of Lactobacillus spp.
MAREK SELWET, MARIOLA GALBAS*, FILIP PORZUCEK*, MICHA£ KOCZOROWSKI*, MA£GORZATA POCIEJOWSKA
Department of General and Environmental Microbiology, Faculty of Agronomy and Bioengineering, University of Life Sciences, ul. Szyd³owska 50, 60-656 Poznañ, Poland
*Department of Biochemistry and Biotechnology, Faculty of Agronomy and Bioengineering, University of Life Sciences, ul. Dojazd 11, 60-632 Poznañ, Poland
Selwet M., Galbas M., Porzucek F., Koczorowski M., Pociejowska M.
Effects of the method of alfalfa ensiling on the content of biogenic amines and numbers of some strains of Lactobacillus spp.
Summary
The investigations involved determining the influence of the way of ensiling of alfalfa on the content of some selected biogenic amines in silages, changes in the content of dry matter, crude protein, lactic and acetic acids as well as of ammonia. The performed microbiological analysis entailed determining total counts and the frequency of occurrence of: Lactobacillus spp. (L. plantarum, L. buchneri, L. brevis), as well as Enterobacte-riaceae bacteria mainly responsible for the level of amine concentrations. Experimental silages were prepared from fresh and wilted Lucerne, also using a chemical additive. The highest biogenic amine totals and the highest counts of Lactobacillus spp. and Enterobacteriaceae bacteria were recorded in silages prepared from wilted alfalfa. The applied chemical additive reduced the level of amines in silages and Enterobacteriaceae counts.
silage from fresh alfalfa, WS silage from wilted alfalfa, and KS silage from fresh alfalfa supplemented with Kemi-Sile 2000 preparation, dose 2.5 lt1
(Kemira, Finland). This preparation con-tained a mixture of propionic, formic and benzoic acids. During the ensiling process there was no light in the facility in which the process took place and the ambient temperature ranged from
10-15°C ± 1°C. Samples for microbiological and chemical analyses were taken from the forage and from silages after 90 days of ensiling. Silage was added to 90 ml of saline solution (0.85%, pH 7) and shaken by hand. From the suspension, 101 to 103 serial dilutions were prepared and
100 µl of the suspension was added to tubes containing a 10 µl MRS broth (Merck, Germany) from the first and last dilutions for enrichment. Then tubes were incubated in an anaerobic jar at 37°C. After one day of incubation, tubes that contained turbidity were spread on plates con-taining MRS agar. After 2 days of incubation at 37°C, pure cultures were obtained. Lactic acid bacteria (LAB) were detected by the presence of yellowish colony. One colony was selected for identification. The biochemical standard tests were used for the identification of isolated organisms and these included: Gram staining, catalase reaction, carbo-hydrate fermentation (glucose, galactose, lactose, manitol and fructose), growth at 10°C and 50°C in MRS broth and hydrolysis of arginine. The MRS broth base containing 0.5% different sugars and 0.004% purple bromo cresol and lacking glucose and meat extract was used for carbohydrate fermentation tests. The same medium containing arginine (0.3%) and sodium citrate (0.2%) was used to test the hydrolysis of arginine (8).
The developed colonies were subjected to the PCR reaction employing appropriate markers with the aim to identify L. plantarum, L. brevis, L. buchneri (Tab. 1).
Enterobacteriaceae were determined by the plate method on the Chromocult Coliform Agar (Merck) selective sub-strate with the incubation time of 24 h and temperature of 37°C. Feed basic composition: dry matter and crude protein were determined according to AOAC (2) and ammonia nitrogen according to Conway methodology (3). Concen-tration of two carboxylic acids were assessed using a gas chromatograph equipped in a FID detector, a Supelco glass 80/100 Chromosorb® WAW column 2 m long, I.D. 2 mm
with 10% GP filling SP 1200/1% H3PO4 and a Varian 8200 CX automatic sampler. Hydrogen was used as carrier gas (30 cm3 min1 flow), furnace temperature of 120°C,
injection temperature 250°C, detector temperature 300°C. Fluka acid standards were treated as reference. The con-tent of biogenic amines (histamine, putrescine, cadaverine, tyramine) was determined with the assistance of the high performance liquid chromatography (HPLC) (Shimadzu) using post-column derivation with ninhydrin dissolved in carrier phase. 50 g of silage aqueous extract was deprotei-nized using 55% trichloroacetic acid, filtrated through a soft filter and centrifuged (4500 rpm for 10 minutes). Samples were then applied onto a Nucleosil C18 column with a solution on DMSO base used as a carrier phase.
Colorful derivatives were obtained as a result of treatment with ninhydrin and a high temperature of 145°C in a co-lumn coil in the reactor (10 m Teflon pipe, ø 0.25 mm) placed behind the column. The content of tyramine, hista-mine, putrescine and cadaverine) were determined with the assistance of a UV-VIS detector at 546 nm wave length using the external standard method (Sigma).
Values of pH were determined using Hann Instruments pH meter in a suspension prepared from 20 g silage and 180 cm3 demineralised water homogenised for 10 minutes.
Statistical calculations were performed with the assistance of procedures of the GLM SAS package (14). Differences between means were tested by Tuckeys test. The analysis of variance (two-factorial model with interaction in a cruci-form system) was described by the following equation:
Xijk = m + ai + bj + (ab)ij + eijk
m designates the mean; ai effect i of the kind of plant material; bj effect j of the method of conservation; (ab)ij
interaction of factors in the (ij) subgroup; eijk effect of factors specific for k of this element of the (ij) subgroup.
Results and discussion
The performed investigations were carried out on silages prepared from alfalfa collected from the first cut harvested at the phase of budding of mean dry matter (DM) concentration in forage of 171.2 g kg1
and crude protein concentration of 181.0 g kg1DM
(Tab. 2). Following 8 h wilting of forages, the content of dry matter increased, on average, to 201.3 g kg1DM.
The ensiling process reduced dry matter content and crude protein concentration both in silages made from fresh as well as from wilted forage (Tab. 2). Dry matter losses in silages were, respectively, as follows: in FS 16.4%, in WS 10% and in KS 5.3%, while levels of crude protein declined by: FS 13.1%, WS 5.1% and KS 5%, respectively. Significantly (P < 0.05)
a ir e t c a b t e g r a T Pciromdeer Pirmersequence(5'® )'3 Tgaergneet PCRa(bmpp)ilcon s u ll i c a b o t c a L m u r a t n a l p 11PP11RF 55''CTTGTTGGATGCTTGCAAGGTTGCCGCCAGAATAGCTTGG33'' recA 249 s u ll i c a b o t c a L s i v e r b 11PP11RF 55''AGCGGACGATGCTATGGGCCTGCTGCGTTATATG3G'3 gyrB 237 s u ll i c a b o t c a L ir e n h c u b 11PP11RF 55''GCCCTGATACATGCTCGGATTCGAAGCTGCAGTATATGTC33' r1R6NSA 193
Tab. 1. PCR primers used in the study
Explanations: DM dry matter; CP crude protein; FS silage from fresh alfalfa; WS silage from wilted alfalfa; KS silage from fresh alfalfa with KemiSile 2000
s r e t e m a r a P s e g a r o f n e e r G Sliages h s e r F a fl a fl a Wafliatleflad FS WS KS g k g M D 1 171.2 201.3 143.2 181.2 162.1 g k g P C 1DM 181.0 173.1 157.2 164.3 172.0
Tab. 2. Mean content of dry matter and crude protein in forage and silage with alfalfa (n = 10)
highest levels of ammonia were recorded in silages prepared from wilted alfalfa. The content of N-NH3 in silages prepared from fresh Lucerne as well as from fresh Lucerne supplemented with a chemical additive was similar and did not differ significantly (P < 0.05) (Tab. 3).
Silages prepared from wilted alfalfa were characte-rised by a significantly (P < 0.05) highest pH. The acidity of silages made from fresh alfalfa (FS and KS)
was lower and was not found to differ significantly (P < 0.05) (Tab. 3). Substantial (P < 0.05) differences were recorded in mean total contents of lactic and acetic acids in individual combinations (Tab. 3). The lowest concentrations of these acids were determined in silages prepared from fresh alfalfa (FS). The applied wilting process was found to significantly (P < 0.05) affect the increase in levels of these acids (WS), and in samples supplemented with the employed chemical agent (KS), the total levels of these acids were the highest. The content of biogenic amines in individual silages varied (P < 0.05). The highest total of biogenic amines was determined in silages prepared from wilted alfalfa, whereas in the case of silages supplemented with a chemical additive, the total biogenic amine content was found to be the lowest (Tab. 4).
The silage made from fresh alfalfa (FS) was cha-racterised by the highest quantities of histamine and tyramine (P < 0.05). In WS and KS combinations, histamine content was found reduced by 72.4% and 49.8%, respectively, while that of tyramine dropped by 30.4% and 21%, respectively. The highest cada-verine content (P < 0.05) was observed in silages prepared from wilted alfalfa (WS). In the FS combi-nation, cadaverine content was lower by 50.1%, while in the KS treatment, the reduction in the content of this compound was determined at 66.8%. Levels of putrescine in silages prepared from fresh alfalfa (FS and KS) were similar (P < 0.05). The highest putrescine content was determined in silages made from wilted Lucerne (WS); it was by 25.7% higher in comparison with FS and by 36.7% when compared with KS. Table 5 presents results of microbiological analyses of forages and silages from Lucerne.
Total counts of Lactobacillus spp. on the experimental fresh and wilted plant material were similar (P < 0.05). Significantly (P < 0.05) highest Lactobacillus spp. counts were determined in silages from wilted Lucerne. The similar numbers of bacteria from the Enterobac-teriaceae family were determined on fresh and wilted Lucerne as well as in silages supplemented with the chemical preparation (KS). Higher (P < 0.05) counts of enterococci were determined in FS and WS treatments. There were varied frequencies of occurrence of the following selected species: Lactobacillus plantarum, Lactobacillus buchneri, Lactoba-cillus brevis (Tab. 5). L. plantarum was found most frequently in fresh and wilted alfalfa. On the other hand, L. buchneri and L. brevis were deter-mined as dominant species in mature silages.
In the case of alfalfa, dry matter content depends of the age of plants. In our investigations, alfalfa was
Explanations: FS silage from fresh alfalfa; WS silage from wilted alfalfa; KS silage from fresh alfalfa with KemiSile 2000; a, b, c means in rows with different superscript letters differ significantly at P < 0.05
Tab. 5. Frequency of occurrence and mean numbers of the examined lactic acid bacteria and Enterobacteriaceae (CFU log10 g1)
a ir e t c a b t e g r a T Greenforages(n=10) Sliages(n=10) a fl a fl a h s e r F Witledaflafla FS WS KS . p p s s u ll i c a b o t c a L 120.2/15a0 210.9/100a 610.4/130b 17.03/140c 160.2/100b m u r a t n a l p s u ll i c a b o t c a L 10/10 10/10 4/10 5/10 3/10 ir e n h c u b s u ll i c a b o t c a L 3/10 4/10 9/10 8/10 10/10 s i v e r b s u ll i c a b o t c a L 2/10 3/10 8/10 10/10 10/10 e a e c a ir e t c a b o r e t n E 17./2110a 14./0100a 19./9180b 19./7120b 19./2140a
Tab. 3. Mean content of fermentation products in alfalfa silages (n = 10)
Explanations: LA lactic acid; AA acetic acid; FS silage from fresh alfalfa; WS silage from wilted alfalfa; KS silage from fresh alfalfa with KemiSile 2000; a, b, c means in rows with different superscript letters differ significantly at P < 0.05
s r e t e m a r a P Sliages S F WS KS H p 4.82a 5.12b 4.51a H N -N 3gkg1DM 31.1a 47.1b 29.2a g k g A L 1DM 87.8a 97.2b 131.2c g k g A A 1DM 37.2a 42.1b 27.1c s d i c a y tt a f l a t o T 125.0a 139.3b 158.3c
Tab. 4. Mean content of biogenic amines in alfalfa silages (n = 10)
Explanations: FS silage from fresh alfalfa; WS silage from wilted alfalfa; KS silage from fresh alfalfa with KemiSile 2000; a, b, c means in rows with different superscript letters differ significantly at P < 0.05 s r e t e m a r a P Sliages S F WS KS g k g m e n i m a t s i H 1DM 1801.3a 1221.0b 1402.1c g k g m e n y c s e rt u P 1DM 1472.6a 1636.2b 1402.7a g k g m e n ir e v a d a C 1DM 3002.7a 6021.2b 1998.2c g k g m e n i m a r y T 1DM 1305.2a 1212.3b 1241.2b s e n i m a c i n e g o i b l a t o T 4581.8a 7090.7b 3044.2c
harvested at the budding phase, from the first cut, which means that young plants were ensiled. Purwin (13) believes that delaying harvest of alfalfa reduces pro-portions of leaves in relation to stems, which may make the process of ensiling more difficult, as a result of, for example, poor compaction of the material in the container. Plant wilting as well as the application of chemical preparations may reduce losses of dry matter in silages (5, 15), as confirmed by the results of our own investigations. Abdelhadia and Tricarico (1) maintain that losses of dry matter in silages in the course of the ensiling process may reach even 10%.
As a result of fermentation processes, high initial protein concentrations in alfalfa forage undergo reduc-tion following proteolysis and further ammonificareduc-tion accompanied by release of N-NH3. The wilting process incurs a strong risk of intensive development of yeasts in silages, which may competitively metabolise carbo-hydrates but this development effectively inhibits the process of proteolysis. In order to limit the develop-ment of undesirable bacterial and fungal microflora during the ensiling process, it is possible to apply chemical preparations. In our own studies, both the applied wilting process as well as the addition of organic acids (dose 2.5 lt1) confined protein losses and
liberation of ammonia and the obtained silages were characterised by low pH corroborating investigations carried out by Selwet (16).
The principal vectors of biogenic amine develop-ment during the ensiling process are lactic bacteria and enterobacteria. Depending on the species of the ensiled plants, numbers of epiphytic lactic bacteria, including Lactobacillus spp., may vary and range from 10 to 105
cfu g1 (11). Following the cutting of plants, counts of
lactic bacteria increase, while numbers of streptococci decrease and Lactobacillus spp. begin to dominate. In our own experiments, the numbers of Lactobacillus spp. were recorded to increase following plant wilting but these differences were insignificant (P < 0.05). In the course of the ensiling process, acidification of the environment is initiated by strains of milk homofer-mentation, e.g. Lactobacillus plantarum, but already after 4 days approximately 85% of them are strains of heterofermentation bacteria, e.g. Lactobacillus buch-neri and L. brevis. These bacteria remain dominant until the end of the ensiling process because they exhibit high tolerance to environmental acidification and pre-sence of acetic acid (17). The frequency of the oc-currence of these species was confirmed by our inve-stigations. Potkañski et al (12) reported a significant decline in the numbers of lactic bacteria populations as a result of treatment of silages with chemical pre-parations, from log 8.77 in the control to log 4.07 in experimental material. In the described experiments, no impact of the applied chemical preparation on the reduction in numbers of these bacteria was observed. Nevertheless, silages supplemented with the chemical
additive were characterised by the highest lactic acid concentrations and lowest pH, which may indicate their high physiological activity in the acid environment. Enterobacteriaceae occur on plant surfaces in small quantities of about 103 cfu g1 (11). These bacteria can
proliferate profusely in silages prepared from wilted plants but are sensitive to environmental acidification and their counts as well as activity decline rapidly. Lactic and acetic acid concentrations depend on the extent of carbohydrate metabolism by bacteria. Wang et al. (19) reported that 1 kg of silage dry matter may contain 91 g of lactic acid and 32 g of acetic acid. Similar profiles were determined in silages from our own experiments.
Undesirable amino acid decarboxylation is associated with high biogenic amine concentrations which occur naturally in plants and silages. Differences in biogenic amine concentrations between plants and silages from which they were prepared may range from 4 to 21% (6). In the experiments presented in this paper, lower concentrations of histamine and tyramine were recor-ded in silages made from wilted alfalfa, which can indicate limited decarboxylation of tyrosine and histi-dine. The performed investigations revealed reduction of biogenic amines under the influence of the applied chemical preparation, which corroborates the results reported by Steidlová and Kalaè (18). Macana et al. (9) claim that the activity of bacterial proteases and, consequently, development of biogenic amines is cor-related with the following: content of amino acids, synergistic action of microorganisms as well as with ensiling conditions. Hernández-Orte et al. (7) maintain that together with the growing population of lactic bacteria, levels of biogenic amines also increase which can be connected with the growing concentrations of acetic and lactic acids.
Recapitulating, it should be said that the applied chemical additive turned out to be the most effective factor limiting the formation of biogenic amines in silages from alfalfa. Levels of biogenic amines were not found to be affected by increased concentrations of plant dry matter, although this treatment exhibited a stimulatory impact on the elevation of amine levels in silages from alfalfa.
References
1.Abdelhadia L. O., Tricarico J. M.: Effects of stage of maturity and microbial inoculation at harvest on nutritive quality and degradability of grain sorghum whole-plant and head-chop silages. Anim. Feed Sci. Technol. 2009, 152, 175-185.
2.Association of Official Analytical Chemists: Official Methods of Analysis AOAC. Arlington, USA 1995.
3.Conway E. J.: Ammonia. General method, [in:] Microdiffusion analysis and volumetric error. Crosby Lockwood. London 1962, 98-100.
4.Dadákova E., Køiek M., Pelikánová
T.: Determination of biogenic amines in foods using ultra-performance liquid chromatography (UPLC). Food Chem. 2009, 116, 365-370.
5.Gawe³ E.: The role of fine-grained legume plants in a farm. Water-Environ-ment-Rural Areas 2011, 11, 73-91.
6.Guo X. S., Ding W. R., Han J. G., Zhou H.: Characterization of protein frac-tions and amino acids in ensiled alfalfa treated with different chemical addi-tives. Anim. Feed Sci. Technol. 2008, 142, 89-98.
7.Hernández-Orte P., Lapeña A. C., Peña-Gallego A., Astrain J., Ferrer B., Cacho J., Ferreira V.: Biogenic amine determination in wine fermented in oak barrels: Factors affecting formation. Food Res. Internat. 2008, 41, 697-706.
8.Kasra-Kermanshahi R., Fooladi J., Peymanfar S.: Isolation and micro-encapsulation of Lactobacillus spp. from corn silage for probiotic applica-tion. Iranian J. Microbiol. 2010, 2, 98-102.
9.Macana J., Turk R., Vukuiæ J., Kipèiæ D., Milkoviæ-Kraus S.: Long-term follow-up of histamine levels in a stored fish meal sample. Anim. Feed Sci. Technol. 2006, 127, 169-174.
10.Õnal A.: Current analytical methods for the determination of biogenic amines in foods. Food Chem. 2007, 103, 1475-1486.
11.Pahlow G., Muck R. E., Driehuis F., Spoelstra S. F.: Typical populations of bacterial and fungal groups on plants prior to ensiling, [in:] Buxton D. R., Harrison J., Muck R.: Silage Science and Technology. T 42, American Society of Agronomy, Madison 2003, 32-33.
12.Potkañski A., Grajewski J., Twaro¿ek M., Selwet M., Miklaszewska B., B³ajet--Kosicka A., Szumacher-Strabel M., Cielak A., Raczkowska-Werwinska K.: Chemical composition, fungal microflora and mycotoxin content in maize silages infected by smut (Ustilago maydis) and the effect of biological and chemical additives on silage aerobic stability. J. Anim. Feed Sci. 2010, 19, 130-142.
13.Purwin C.: Quality of the grass and grass-legume silages making by baler technology. Dissertations and Monographs, University Publisher. University of Warmia and Mazury in Olsztyn 2007, 127-125.
14.SAS: Users Guide: Statistics, Version 7 ed. SAS Inst. Inc. 1998, Cary, NC. 15.Selwet M.: Effect of organic acid on numbers of yeasts and mould fungi and aerobic stability in the silage of corn. Polish J. Vet. Sci. 2008b, 11, 119-123. 16.Selwet M.: Effect of organic acids on nutritive value, yeast numbers, mould fungi and aerobic stability in red clover silage. Hung. J. Anim. Prod. 2008a, 1, 73-80.
17.Selwet M.: Influence of organic acids and bacterial-enzymatic preparations on the aerobic stability of silages during oxygen exposure-model research. Dissertations and Monographs, University Publisher. University of Life Sciences Poznañ 2010, 404, p. 148.
18.Steidlová ., Kalaè P.: Levels of biogenic amines in maize silages. Anim. Feed Sci. Technol. 2002, 102, 197-205.
19.Wang J., Wang J. Q, Zhou H., Feng T.: Effects of addition of previously fermented juice prepared from alfalfa on fermentation quality and protein degradation of alfalfa silage. Anim. Feed Sci. Technol. 2009, 151, 280-290. Coresponding author: Dr hab. Marek Selwet, ul. Szyd³owska 50, 60-656 Poznañ, Poland; e-mail: mselwet@jay.au.poznan.pl
