Short communication
CB 2 and TRPV 1 receptors mediate cannabinoid actions on MDR1 expression in multidrug
resistant cells
Jonathon C. Arnold1, Phoebe Hone1, Michelle L. Holland1, John D. Allen2
1School of Medical Sciences (Pharmacology) and Bosch Institute, The University of Sydney, NSW 2006, Sydney, Australia
2The Centenary Institute of Cancer Medicine and Cell Biology, NSW 2006, Sydney, Australia Correspondence: Jonathon C. Arnold, e-mail: jonathon.arnold@sydney.edu.au
Abstract:
Background: Cannabis is the most widely used illicit drug in the world that is often used by cancer patients in combination with con- ventional anticancer drugs. Multidrug resistance (MDR) is a major obstacle in the treatment of cancer. An extensively characterized mechanism of MDR involves overexpression of P-glycoprotein (P-gp), which reduces the cellular accumulation of cytotoxic drugs in tumor cells.
Methods: Here we examined the role of cannabinoid receptors and transient receptor potential vanilloid type 1 (TRPV1) receptors in the effects of plant-derived cannabinoids on MDR1 mRNA expression in MDR CEM/VLB100cells which overexpress P-gp due to MDR1gene amplification.
Results: We showed that both cannabidiol (CBD) and D9-tetrahydrocannabinol (D9-THC) (10 µM) transiently induced the MDR1 transcript in P-gp overexpressing cells at 4 but not 8 or 48 h incubation durations. CBD and THC also concomitantly increased P-gp activity as measured by reduced accumulation of the P-gp substrate Rhodamine 123 in these cells with a maximal inhibitory effect observed at 4 h that slowly diminished by 48 h. CEM/VLB100cell lines were shown to express CB2and TRPV1receptors. D9-THC effects on MDR1 expression were mediated by CB2receptors. The effects of CBD were not mediated by either CB2or TRPV1recep- tors alone, however, required activation of both these receptors to modulate MDR1 mRNA expression.
Conclusion: This is the first evidence that CB2and TRPV1receptors cooperate to modulate MDR1 expression.
Key words:
cannabinoids, P-glycoprotein, CB2, TRPV1
Introduction
Multidrug resistance (MDR) is a major obstacle in the treatment of cancer. MDR reduces the sensitivity of tumor cells to an array of structurally and functionally unrelated compounds, often through repeated expo- sure to cytotoxic agents [3, 28]. An extensively char- acterized mechanism of MDR involves a 170 kDa ef-
flux transporter termed P-glycoprotein (P-gp) [13], which reduces the cellular accumulation of diverse cytotoxic drugs [8]. P-gp belongs to the superfamily of adenosine triphosphate (ATP)-binding cassette (ABC) transporters [9] and is encoded by the MDR1 gene [17, 27]. P-gp was discovered due to its role in mediating MDR in cancer, however, it is also ex- pressed in many tissues throughout the body where its
Pharmacological Reports 2012, 64, 751757 ISSN 1734-1140
Copyright © 2012 by Institute of Pharmacology Polish Academy of Sciences
world and it is being increasingly used for medicinal purposes. The widespread use of this drug raises the question of whether plant-derived cannabinoids affect MDR1 expression. This might have implications for MDR and also the pharmacokinetics of co-administered therapeutic drugs. We have shown that the most abun- dant cannabinoid constituents, D9-tetrahydrocannab- inol (D9-THC) and cannabidiol (CBD), inhibit P-gp expression in the acute T lymphoblastoid leukemic line CEM/VLB100 which overexpresses P-gp due to MDR1gene amplification [2, 12]. Here we examined the role of cannabinoid and transient receptor poten- tial vanilloid type 1 (TRPV1) receptors in the effects of cannabinoids on MDR1 mRNA expression.
Materials and Methods
Cell lines
The CEM/VLB100 cell line over-expresses P-gp, as a result of MDR1 gene amplification, yielding an ap- proximate 200- to 800-fold resistance to VLB [12].
The cell line was grown in complete medium consist- ing of RPMI-1640 supplemented with 10% (v/v) fetal calf serum (FCS), 50 IU/ml penicillin and 50 mg/ml streptomycin (all purchased from Invitrogen, Austra- lia) in a humidified atmosphere of 5% CO2at 37°C.
Cells were grown in 75 cm2culture flasks maintained at a density between 105and 106cells/ml, in exponen- tial growth, and subcultured every 3–4 days. Viable cells were counted on a hemocytometer using trypan blue exclusion.
Drugs and drug treatment
D9-THC and CBD were purchased from Sigma-Aldrich (Sydney, NSW) and Tocris Cookson Inc. (Sydney, NSW), respectively, and prepared as described previ- ously [10–12]. The selective CB2receptor antagonist SR 144528 (Sanofi-Aventis Pharmaceuticals, France) and the selective TRPV1 receptor antagonist SB 366791 (Sapphire Biosciences, Australia) were stored as stock solutions in ethanol and were diluted with complete medium prior to each experiment. The final ethanol concentration in the medium never exceeded
(VEH), in each case diluted in complete medium and incubated for 4, 8 or 48 h. In 4 h experiments where cannabinoid receptor antagonists were also included, they were added at the same time as the cannabinoids, to a final concentration of 5 µM. For each drug treat- ment and incubation time we repeated the experiment at least 3 times in separate culture flasks. RNA was extracted on each occasion and analyzed in triplicate by real time reverse transcriptase polymerase chain reaction (real time RT PCR).
RNA extraction and reverse transcription
Total RNA was isolated using the TRIzol reagent (In- vitrogen, Australia). RNA was treated with DNase I to remove any contaminating genomic DNA. The con- centration of RNA was assessed using the Nanodrop ND-1000 (NanoDrop Technologies Inc., USA). RNA (2 µg) was reverse transcribed with moloney-murine leukemia virus reverse transcriptase (Promega, Aus- tralia), random hexamers and dNTPs.
Real time reverse transcriptase polymerase chain reaction
The real-time reverse transcriptase polymerase chain reaction (RT PCR) was performed in multiplex using TaqMan Gene Expression Assay primer and probes and TaqMan Universal PCR Master Mix (Applied Biosystems, USA). Briefly, PCR was performed in triplicate in standard 96-well plates containing 1.25 µl of TaqMan MDR1 forward and reverse primers and MGB FAM-labelled probe, 1.25 µl of the TaqMan en- dogenous control 18s rRNA forward and reverse primers and MGB VIC-labelled probe, 12.5 µl of TaqMan universal PCR master mix, 1 µl of cDNA template and 9 µl of diethyl pyrocarbonate (DEPC)- treated water to give a total reaction volume of 25 µl per well. The RT PCR products were amplified using the ABI Prism 7000 Sequence Detection System (Ap- plied Biosystems, USA). Thermal cycling conditions were 50°C for 2 min, followed by 95°C for 10 min, 40 cycles of 95°C for 15 s, with a final annealing tem- perature of 60°C for 60 s. TaqMan primers and probes were designed to amplify a 67 bp region of the MDR1 mRNA sequence (NCBI Entrez nucleotide sequence ID: NM_000927.3), and a 187 bp amplicon from the
18s rRNA mRNA sequence (NCBI Entrez nucleotide sequence ID: X03205.1). A non-template control us- ing DEPC-treated water instead of cDNA was used as a negative control in each plate analyzed.
RT-PCR analysis of receptor expression
All receptor PCR reactions were performed using 0.05 × the final volume of template in reactions con- sisting of 1 × HotStarTaq PCR buffer, 125 nM of each primer, 100 nM dNTPs and 0.1 U/µl of HotStarTaq DNA Polymerase. Thermal cycling conditions con- sisted of an initial activation step of 95°C for 15 min, followed by n cycles of 94°C for 45 s, annealing temperature (Tm) °C for 20 s and 72°C for 30 s, with a final cycle of 72°C for 5 min. Both the number of amplification cycles (n), and the Tm were determined for each primer set. Primers were designed based on sequences available from the National Centre for Bio- technology Information databases, using Primer 3 software [22]. Where alternatively spliced transcripts of the gene exist, primers were designed across a re- gion that is common to all variants. Specific reaction conditions, primer sequences and amplicon sizes are described in Table 1. We utilized a negative RT con- trol which showed no signal upon amplification high- lighting that our product derived from cDNA rather than genomic DNA.
Rhodamine 123 accumulation assay of P-gp activity
Cells were plated at 2 × 105/ml and 1/10thvolume of 11X cannabinoids added to wells to a final concentra- tion of 10 µM, 48, 8 or 4 h prior to harvest. Untreated controls received 1/10thvolume complete medium 4 h prior to harvest. At harvest, cells were pelleted, washed free of cannabinoids, and resuspended in complete medium. Rhodamine 123 accumulation was performed in triplicate. Aliquots of 0.5 ml (~4 × 105) cells were transferred to 5 ml serology tubes pre- loaded with 0.5 ml 1 µM Rhodamine 123 in complete medium. The racked tubes were placed in a humidi- fied CO2 incubator at 37°C for 60 min, with quick mixing every 20 min, and then cooled in ice-water slurry. Cells were pelleted by centrifugation at 2°C, washed once with PBS containing 1% FCS and 1 mM EDTA, resuspended in 0.3 ml of the same, and kept on ice until analysis. Rhodamine 123 accumulation was assayed by flow cytometry, using 488 nm excita- tion and 530 nm fluorescence.
Data analysis
The changes in gene expression levels were evaluated by relative quantification between cDNA templates from drug-treated cells and their respective vehicle- treated controls at each time point. The expression of the housekeeping gene, 18s rRNA, was used as an en-
CB2and TRPV1mediate cannabinoid action on MDR1 expression
Jonathon C. Arnold et al.
Tab. 1. National Centre for Biotechnology Information database accession number, primer sequences, annealing temperature (Tm), amplifica- tion cycle number (n) and amplicon sizes of CB1, CB2 and TRPV1 receptor mRNA
Accession (mRNA) Forward primer (5’-3’) Reverse primer (5’-3’) Tm (°C) n Amplicon size (bp)
cDNA DNA
Cannabinoid receptor (CB1)
NM_016083.3 aagaccctggtcctgatcct cgcaggtccttactcctcag 52 35 188 188
Cannabinoid receptor (CB2)
NM_001841 tagacacggacccctttttg ttctcccaagtccctcattg 57 35 243 243
Transient Receptor Potential Vanilloid (subtype 1) (TRPV1)
NM_080704 gcctggagctgttcaagttc tctcctgtgcgatcttgttg 56 35 177 177
b actin (ACTB)
NM_001101 ggacttcgagcaagagatgg agcactgtgttggcgtacag 55 30 234 329
cordance with ‘delta-delta method’ used by Applied Biosystems [20]. Real-time RT PCR CTresults were analyzed using Sequence detection software version 1.2.3 (Applied Biosystems, USA) where baseline and threshold parameters were kept constant between plates. The relative expression ratios between treated and vehicle control groups were statistically analyzed using the non-parametric Mann-Whitney U test as an equality of variance F-test showed that the variance between experimental groups were heterogenous.
Rhodamine 123 accumulation was analyzed by one- way ANOVA with the difference between untreated cells and the 4, 8 and 48 h time-points tested explic- itly by Tukey’s post-test (here, variances were homo- geneous).
We determined whether changes in MDR1 mRNA levels occurred in the CEM/VLB100cells in response to treatment with cannabinoids for 4, 8 or 48 h. At 4 h, both D9-THC and CBD (10 µM) significantly in- creased MDR1 mRNA expression, by approximately 2.5 and 2.0 fold, respectively, over VEH-treated cells (p < 0.05, Fig. 1A, B). The induction of the MDR1 transcript was short-lived as no significant effects were observed at 8 or 48 h for either cannabinoid. The functional consequences of MDR1 induction were tested by cellular Rhodamine 123 accumulation; the dye is a good P-gp substrate and its accumulation is inversely related to P-gp efflux activity. The increased MDR1 transcript levels in the cannabinoid-treated cells were accompanied by reduced Rhodamine 123
Fig. 1. Effects of cannabinoids on MDR1mRNA levels and P-gp function.
The mean (± SEM) MDR1 mRNA ex- pression relative to vehicle-treated CEM/VLB100cells following treatment for 4, 8 and 48 h with (A) 10 µM D9-THC and (B) 10 µM CBD. (C, D) Conse- quent changes in cellular Rhodamine 123 accumulation; relative to un- treated controls. The levels of MDR1 mRNA were normalized to the 18s rRNA housekeeping gene. Statistical significance is denoted by * p < 0.05,
** p < 0.01 or *** p < 0.001 (n = 3–4 per group)
accumulation (Fig. 1C, D). The increased P-gp activ- ity persisted longer than the elevated transcript level as reduced Rhodamine 123 accumulation was ob- served for all THC and CBD incubation times (that is 4, 8 and 48 h) compared to untreated controls. Such an effect is consistent with P-gp protein having a longer half-life than MDR1 transcript [1, 5, 21].
However, a maximal inhibitory effect on Rhodamine 123 accumulation was observed at 4 h which slowly dissipated as Rhodamine 123 levels were significantly higher at 48 h than the 4 h time-point for both THC and CBD (p < 0.001 and 0.05, respectively).
The ability of D9-THC or CBD to modulate MDR1 mRNA levels raises the important question of whether such effects are mediated by receptors. We assessed the expression in CEM/VLB100cells of some common targets of cannabinoid drugs, namely CB1, CB2 and TRPV1receptors, using RT-PCR [19]. Both CB2 and TRPV1receptor mRNAs were found to be present in these cells, but not CB1receptor mRNA (Fig. 2). We then attempted to block the induction of MDR1 by CBD or D9-THC with receptor antagonists. The CB2 receptor antagonist, SR 144528, effectively blocked D9-THC-induced upregulation of MDR1 mRNA (p <
0.05, Fig. 3) whereas the TRPV1 receptor antagonist
SB 366791 had little, if any, effect. In contrast, the combination of these antagonists was required to re- verse CBD-mediated induction of MDR1 mRNA (p <
0.05, Fig. 3). Neither SR 144528, SB 366791 or their combination significantly modulated MDR1 mRNA in the absence of cannabinoid exposure compared to VEH-treated CEM/VLB100 cells (83.33 ± 10.40, 184.30 ± 72.12, 79.67 ± 20.33; the mean ± SEM, re- spectively).
Discussion
D9-THC and CBD were shown to modulate MDR1 gene expression by inducing the levels of transcript in CEM/VLB100 cells. In the present study, 10 µM D9-THC significantly increased the level of MDR1 mRNA at 4 h in CEM/VLB100 cells. The effect on MDR1 mRNA expression was only short-lived as it was not sustained at 8 or 48 h. The consequent in- crease in P-gp activity, reflected in reduced Rhodam- ine 123 accumulation, persisted longer, as expected from the half-life of the protein [1, 5, 21]. Further, we
CB2and TRPV1mediate cannabinoid action on MDR1 expression
Jonathon C. Arnold et al.
Fig. 3. Effect of cannabinoid receptor antagonists on cannabinoid in- duction of MDR1 mRNA. Graphs show the mean (± SEM) MDR1 mRNA expression, relative to vehicle-treated controls (VEH), of CEM/VLB100cells treated with (A) 10 µM D9-THC and (B) 10 µM CBD, co-administered with either VEH or 5 µM of the CB2receptor antagonist SR 144528 and/or the TRPV1 receptor antagonist SB 366791 for 4 h. The levels of MDR1 mRNA were normalized to the 18s rRNA housekeeping gene. Statistical significance was determined by comparing cannabinoid-antagonist relative to the cannabinoid- VEH control group (* p < 0.05, n = 3–4 per condition)
Fig. 2. The expression of CB1, CB2 and TRPV1 mRNA in MCF-7 (+ve) and CEM/VLB100 (VLB) cells as determined by RT-PCR.
b-Actin (ACTB) was used as a control for cDNA quality. Water was used as a negative control (–ve). n = 2, single experiment shown
ent on slightly different mechanisms, with the actions of D9-THC mediated by the CB2 receptor alone, whereas CBD’s effects required both CB2and TRPV1 activation, as neither a CB2 or a TRPV1 antagonist alone were effective in reversing CBD-induced MDR1 mRNA upregulation.
In the present study, 10 µM D9-THC and CBD tran- siently increased the level of MDR1 mRNA that cor- related with increased functional P-gp activity as sup- ported by reduced Rhodamine 123 accumulation in CEM/VLB100 cells at 4 h but not 8 or 48 h. We have previously demonstrated that CBD and D9-THC re- duce the protein expression of P-gp in CEM/VLB100 cells after 72 h exposure, which correlated with in- creased Rhodamine 123 accumulation and enhanced sensitivity of the cells to the cytotoxic actions of the P-gp substrate, vinblastine [12]. Taken together with the present results this suggests that THC and CBD have opposing effects on P-gp expression and conse- quent transport capacity that is dependent on incuba- tion duration – that is short-term cannabinoid expo- sure (4 h) transiently increases P-gp transport whereas longer-term exposure (72 h) decreases P-gp activity.
The literature is replete with examples of cannabi- noids having biphasic effects on various biological measures e.g., [6, 18, 25, 26]. The mechanism respon- sible for this biphasic action of cannabinoids on P-gp expression and activity requires further investigation.
D9-THC binds to both CB1and CB2with similar af- finities and behaves as a partial agonist at these recep- tors [7, 14, 16, 19, 29], however, it does not bind TRPV1receptors [15]. Thus, given that only CB2re- ceptor mRNA was found expressed in CEM/VLB100 cells, it is not surprising that this receptor accounted for all of D9-THC’s ability to upregulate MDR1 mRNA. Interestingly, CBD exhibited a more complex profile, as only combination blockade of CB2 and TRPV1 significantly inhibited CBD-induced MDR1 mRNA expression, and neither CB2 nor TRPV1 an- tagonists were effective when tested alone. CBD, in its (–)-enantiomeric form utilized here, lacks affinity for CB1and CB2receptors, unlike its (+)-enantiomer which displays significant affinity for both receptor subtypes [4]. This raises the possibility that CBD’s ef- fectiveness here is explained by CBD’s propensity to inhibit endogenous fatty acid amide hydrolase and elevate levels of the endocannabinoid anandamide.
CBD exposure. Here we provide the first evidence showing that TRPV1 and CB2receptors may cooper- ate to affect MDR1 expression.
Acknowledgments:
This work was supported by a National Health and Medical Research Council (NH&MRC) Project Grant and a NARSAD Young Investigator Award awarded to JCA.
References:
1.Aleman C, Annereau JP, Liang XJ, Cardarelli CO, Taylor B, Yin JJ, Aszalos A, Gottesman MM: P-glycoprotein, expressed in multidrug resistant cells, is not responsible for alterations in membrane fluidity or membrane poten- tial. Cancer Res, 2003, 63, 3084–3091.
2.Beck WT, Mueller TJ, Tanzer LR: Altered surface mem- brane glycoproteins in Vinca alkaloid-resistant human leu- kemic lymphoblasts. Cancer Res, 1979, 39, 2070–2076.
3.Biedler JL, Riehm H: Cellular resistance to actinomycin D in Chinese hamster cells in vitro: cross-resistance, ra- dioautographic, and cytogenetic studies. Cancer Res, 1970, 30, 1174–1184.
4.Bisogno T, Hanus L, De Petrocellis L, Tchilibon S, Ponde DE, Brandi I, Moriello AS, Davis JB et al.:
Molecular targets for cannabidiol and its synthetic ana- logues: effect on vanilloid VR1 receptors and on the cel- lular uptake and enzymatic hydrolysis of anandamide.
Br J Pharmacol, 2001, 134, 845–852.
5.Chin KV, Tanaka S, Darlington G, Pastan I, Gottesman MM: Heat shock and arsenite increase expression of the multidrug resistance (MDR1) gene in human renal carci- noma cells. J Biol Chem, 1990, 265, 221–226.
6.Fan SF, Yazulla S: Biphasic modulation of voltage- dependent currents of retinal cones by cannabinoid CB1 receptor agonist WIN 55212-2. Vis Neurosci, 2003, 20, 177–188.
7.Felder CC, Joyce KE, Briley EM, Mansouri J, Mackie K, Blond O, Lai Y, Ma AL et al.: Comparison of the phar- macology and signal transduction of the human cannabi- noid CB1 and CB2 receptors. Mol Pharmacol, 1995, 48, 443–450.
8.Fojo A, Akiyama S, Gottesman MM, Pastan I: Reduced drug accumulation in multiply drug-resistant human KB carcinoma cell lines. Cancer Res, 1985, 45, 3002–3007.
9.Gottesman MM, Fojo T, Bates SE: Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer, 2002, 2, 48–58.
10.Holland ML, Allen JD, Arnold JC: Interaction of plant cannabinoids with the multidrug transporter ABCC1 (MRP1). Eur J Pharmacol, 2008, 591, 128–131.
11.Holland ML, Lau DT, Allen JD, Arnold JC: The multidrug transporter ABCG2 (BCRP) is inhibited by plant-derived cannabinoids. Br J Pharmacol, 2007, 152, 815–824.
12.Holland ML, Panetta JA, Hoskins JM, Bebawy M, Rou- fogalis BD, Allen JD, Arnold JC: The effects of cannabi- noids on P-glycoprotein transport and expression in mul- tidrug resistant cells. Biochem Pharmacol, 2006, 71, 1146–1154.
13.Juliano RL, Ling V: A surface glycoprotein modulating drug permeability in Chinese hamster ovary cell mutants.
Biochim Biophys Acta, 1976, 455, 152–162.
14.Karl T, Cheng D, Garner B, Arnold JC: The therapeutic potential of the endocannabinoid system for Alzheimer’s disease. Expert Opin Ther Targets, 2012, 16, 407–420.
15.Lam PM, McDonald J, Lambert DG: Characterization and comparison of recombinant human and rat TRPV1 receptors: effects of exo- and endocannabinoids. Br J Anaesth, 2005, 94, 649–656.
16.Long LE, Chesworth R, Huang XF, McGregor IS, Arnold JC, Karl T: Transmembrane domain Nrg1 mutant mice show altered susceptibility to the neurobehavioural actions of repeated THC exposure in adolescence. Int J Neuropsychopharmacol, 2012, 1–13.
17.Milojkovic M, Stojnev S, Jovanovic I, Ljubisavljevic S, Stefanovic V, Sunder-Plassman R: Frequency of the C1236T, G2677T/A and C3435T MDR1 gene polymor- phisms in the Serbian population. Pharmacol Rep, 2011, 63, 808–814.
18.Parker LA, Kwiatkowska M, Burton P, Mechoulam R:
Effect of cannabinoids on lithium-induced vomiting in the Suncus murinus (house musk shrew). Psychopharma- cology (Berl), 2004, 171, 156–161.
19.Pertwee RG: The diverse CB1 and CB2 receptor phar- macology of three plant cannabinoids: D9-tetrahydroca- nnabinol, cannabidiol and D9-tetrahydrocannabivarin.
Br J Pharmacol, 2008, 153, 199–215.
20.Pfaffl MW: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res, 2001, 29, e45.
21.Richert ND, Aldwin L, Nitecki D, Gottesman MM, Pastan I: Stability and covalent modification of
P-glycoprotein in multidrug-resistant KB cells. Bio- chemistry, 1988, 27, 7607–7613.
22.Rozen S, Skaletsky H: Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol, 2000, 132, 365–386.
23.Schinkel AH, Mayer U, Wagenaar E, Mol CA, van Deemter L, Smit JJ, van der Valk MA, Voordouw AC et al.: Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting)
P-glycoproteins. Proc Natl Acad Sci USA, 1997, 94, 4028–4033.
24.Spiro AS, Wong A, Boucher AA, Arnold JC: Enhanced brain disposition and effects of D9-tetrahydrocannabinol in p-glycoprotein and breast cancer resistance protein knockout mice. PLoS One, 2012, 7, e35937.
25.Sulcova E, Mechoulam R, Fride E: Biphasic effects of anandamide. Pharmacol Biochem Behav, 1998, 59, 347–352.
26.Tzavara ET, Wade M, Nomikos GG: Biphasic effects of cannabinoids on acetylcholine release in the hippocam- pus: site and mechanism of action. J Neurosci, 2003, 23, 9374–9384.
27.Ueda K, Cornwell MM, Gottesman MM, Pastan I, Roninson IB, Ling V, Riordan JR: The mdr1 gene, responsible for multidrug-resistance, codes for P-glycoprotein. Biochem Biophys Res Commun, 1986, 141, 956–962.
28.Wang Z, Ravula R, Cao M, Chow M, Huang Y:
Transporter-mediated multidrug resistance and its modu- lation by Chinese medicines and other herbal products.
Curr Drug Discov Technol, 2010, 7, 54–66.
29.Wong A, Gunasekaran N, Hancock DP, Denyer GS, Meng L, Radford JL, McGregor IS, Arnold JC: The ma- jor plant-derived cannabinoid D9-tetrahydrocannabinol promotes hypertrophy and macrophage infiltration in adipose tissue. Horm Metab Res, 2012, 44, 105–113.
Received: April 18, 2011; in the revised form: January 17, 2012;
accepted: February 2, 2012.
CB2and TRPV1mediate cannabinoid action on MDR1 expression
Jonathon C. Arnold et al.
