Acid Fermentation in Lactococcus lactis
Pranav Puri,aAnisha Goel,b,c* Agnieszka Bochynska,aBert Poolmana
Department of Biochemistry, Groningen Biomolecular Sciences and Biotechnology Institute, Netherlands Proteomics Centre, and Zernike Institute for Advanced Materials, University of Groningen, Groningen, The Netherlandsa; Systems Bioinformatics IBIVU, Vrije Universiteit Amsterdam, Amsterdam, The Netherlandsb; Laboratory of Microbiology, Wageningen University and Research Centre, Wageningen, The Netherlandsc
Acetate kinase (ACK) converts acetyl phosphate to acetate along with the generation of ATP in the pathway for mixed-acid fer-mentation in Lactococcus lactis. The reverse reaction yields acetyl phosphate for assimilation purposes. Remarkably, L. lactis has two ACK isozymes, and the corresponding genes are present in an operon. We purified both enzymes (AckA1 and AckA2) from L. lactis MG1363 and determined their oligomeric state, specific activities, and allosteric regulation. Both proteins form homodi-meric complexes, as shown by size exclusion chromatography and static light-scattering measurements. The turnover number of AckA1 is about an order of magnitude higher than that of AckA2 for the reaction in either direction. The Kmvalues for acetyl
phosphate, ATP, and ADP are similar for both enzymes. However, AckA2 has a higher affinity for acetate than does AckA1, sug-gesting an important role under acetate-limiting conditions despite the lower activity. Fructose-1,6-bisphosphate, glyceralde-hyde-3-phosphate, and phospho-enol-pyruvate inhibit the activities of AckA1 and AckA2 to different extents. The allosteric reg-ulation of AckA1 and AckA2 and the pool sizes of the glycolytic intermediates are consistent with a switch from homolactic to mixed-acid fermentation upon slowing of the growth rate.
L
actococcus lactis is a Gram-positive, anaerobic,non-spore-forming bacterium that produces lactic acid from glucose or lactose when grown in batch culture. This homolactic fermenta-tion is used as a trait in the biotechnology industry, as acidificafermenta-tion of the environment is an important parameter in the preservation and shelf life of food products (1,2). L. lactis lacks a heme biosyn-thesis pathway (3). However, if L. lactis is grown in the presence of heme in the culture medium, it can synthesize a minimal electron transfer chain and form a proton motive force by a simple form of respiration (4). This increases the biomass production and ro-bustness of the bacteria (4–6). However, under most conditions the (energy) metabolism of L. lactis is strictly fermentative. De-pending on the availability of carbohydrate source, the fermenta-tion can be homolactic or mixed acid. Mixed-acid fermentafermenta-tion yields an additional ATP and acetic acid, formate, and ethanol as end products (7,8) (Fig. 1). The exact mechanism responsible for the shift from homolactic to mixed-acid fermentation and vice
versa is not well understood. In fact, in one hypothesis, the
meta-bolic shift is controlled by fructose 1,6-bisphosphate (FBP) (7,9). The concentration of FBP increases with increasing glucose flux, and the metabolite has been shown to be an allosteric activator of pyruvate kinase (PK) (10,11) and lactate dehydrogenase (LDH) (7). During starvation, the concentration of FBP decreases, which reduces PK and LDH activity and thereby the glycolytic flux. In L.
lactis lysates, FBP has been shown to inhibit acetate kinase (ACK)
and phosphotransacetylase (PTA) (12). Other metabolites whose concentrations significantly change during growth of L. lactis in car-bon-limited medium are dihydroxyacetone phosphate (DHAP) and glyceraldehyde-3-phosphate (G3P). DHAP and G3P are allo-steric inhibitors of pyruvate formate lyase (PFL), the enzyme that catalyzes the reversible conversion of pyruvate and coenzyme A (CoA) to formate and acetyl-CoA. In principle, a decrease in con-centration of these triose phosphates could result in a metabolic shift to mixed-acid fermentation products (13,14). Besides these glycolytic intermediates, an important role is attributed to the
NADH/NAD⫹ratio, which has been shown to control the flux through both glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and LDH. While GAPDH activity is low at high NADH/NAD⫹ratios, the activity of LDH is positively modulated by high NADH/NAD⫹ratios (15). Other mechanisms of regula-tion of the fermentaregula-tion shift include changes in the expression levels of specific genes (pfl [16] and the las operon [15], the latter of which encodes phosphofructokinase [PFK], PK, and LDH). In a “multi-omics” analysis on L. lactis grown at different growth rates in a chemostat, relatively small changes in the proteome dur-ing the shift from mixed-acid to homolactic fermentation (A. Goel et al., unpublished data) were observed, which suggests that ex-pression regulation is insufficient to explain the metabolic shift.
ACK converts acetyl phosphate to acetate along with the phos-phorylation of ADP and is one of the most prominent ATP-gen-erating reactions in anaerobic microorganisms. Acetate kinase (EC 2.7.2.1) was first discovered 70 years ago in extracts from
Lactobacillus delbrueckii, but the activity has been described for
facultative and obligate anaerobes (17,18), including Escherichia
coli, Salmonella enterica serovar Typhimurium (18), and various thermophilic bacteria (19,20). The reaction catalyzed by acetate kinase is reversible and requires monovalent (K⫹) and divalent (Mn2⫹or Mg2⫹) cations. The equilibrium lies far toward ATP formation, with an equilibrium constant in the range of 200 to
Received 28 October 2013 Accepted 16 January 2014 Published ahead of print 24 January 2014
Address correspondence to Bert Poolman, b.poolman@rug.nl.
* Present address: Anisha Goel, Cell Systems Engineering Section, Department of Biotechnology, Delft University of Technology, Delft, The Netherlands. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/JB.01277-13
1,500 (21). Despite its importance in microbial metabolism, the regulation of acetate kinase activity is poorly documented.
It is not common for organisms to have more than one gene encoding acetate kinase, and the enzyme has been described as a homodimer in E. coli (18) and Methanosarcina thermophila (19) and as a homotetramer in Bacillus stearothermophilus (22). In L.
lactis subsp. cremoris, two isozymes of acetate kinase are present.
The loci of both genes lie very near each other and are thought to be under the control of the same promoter. Both genes are 1,188 bp long and have very high sequence similarity at the nucleotide and amino acid levels (67% identity). The current study was aimed at gaining a better understanding of the enzymology of the two acetate kinases of L. lactis and the role of the two enzymes in the regulation of the metabolic shift, i.e., from homolactic to mixed-acid fermentation.
MATERIALS AND METHODS
Ligation-independent cloning. Expression vectors used for cloning and
expression of acka1 and acka2 were pBADnLIC and pBADcLIC, and E. coli MC1061 was used as the expression host (23). Plasmid DNA was purified from E. coli by using a miniprep kit (Qiagen). The sequences of acka1 and acka2 were obtained from the NCBI database and used to design the primers for amplification of the genes by PCR. The oligonucleotide prim-ers 5=-ATTGGCTAGTCTGTCAGTA-3= and 5=-CACAAGAAGAATTCC GGCAATCC-3= were used to amplify both genes from L. lactis subsp. cremoris MG1363 genomic DNA in a single template. Primers (0.5M), deoxynucleoside triphosphates (dNTPs; 200M), 1 U of Phusion DNA polymerase (New England BioLabs [NEB]), and 20 ng of DNA were used in a reaction volume of 50l. PCR cycles included denaturation of the DNA at 98°C for 5 min, followed by 35 cycles of 98°C for 20 s, 55°C for 20 s, and 72°C for 90 s, with a final cycle of 72°C for 5 min. PCR amplification products were purified from agarose gels (1%), electrophoresis in Tris-acetate-EDTA buffer, and extracted from the gel by using a PCR cleanup and gel extraction kit (Macherey-Nagel). The template so obtained was digested with BglII (NEB) to separate acka1 and acka2. Digestion was performed in 20-l reaction volumes containing the amplified long DNA fragment (15l), NEB buffer 3 (2 l), and BglII (1 U; New England BioLabs), and the mixture was incubated at 37°C for 60 min. Next, prim-ers were designed for ligation-independent cloning (LIC) of acka1 and acka2 in pBADnLIC and pBADcLIC (Table 1). Amplification reactions were performed in a 50-l volume containing restriction digestion prod-ucts as template DNA, each primer (0.5M), dNTPs (200 M), and 1 U of Phusion DNA polymerase (New England BioLabs). PCR and purifica-tion of the DNA were performed as described above. T4 polymerase
treat-ment of vector and insert was performed in 15-l reaction volumes con-taining 250M dCTP/dGTP, 200 ng of vector, and T4 polymerase (1 U; Roche), and the mixture was incubated at room temperature for 30 min as described previously (24). The ligations of vector and insert were per-formed in 12-l reaction volumes containing a vector and insert at a ratio of 1:3. The mixture was incubated at room temperature for 5 min and then transformed to competent E. coli MC1061, according to the standard protocol (25).
Optimization of protein expression. Five milliliters of E. coli culture
induced with 0.01% (wt/vol) arabinose for 2 h was resuspended in ice-cold 50 mM KPi(pH 7.0) with 10% glycerol, 1 mM magnesium sulfate, 0.1 mg/ml DNase, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 300 mg of glass beads (0.1-m diameter). Cells were ruptured for 5 min at 50 Hz in a tissue lyser (Qiagen). To the cell lysate was added 5 mM EDTA to minimize protein degradation and aggregation. Samples were centrifuged for 15 min at 16,000⫻ g in a tabletop centrifuge at 4°C. Proteins were separated by SDS-PAGE and analyzed by Western blotting, using an an-tibody against the His tag epitope and visualized by chemiluminescence of alkaline phosphatase by using the Fujifilm LAS-3000 imager.
Protein purification and molecular mass determinations. Cells
ex-pressing either AckA1 or AckA2 were grown at 37°C in 1 liter of LB me-dium (1.0% tryptone, 0.5% yeast extract, 1.0% NaCl) and 100g/ml ampicillin. Expression in E. coli was induced at an optical density at 600 nm of 0.4 by the addition of 0.01% (wt/vol)L-arabinose. E. coli cells
har-boring pBADcLIC acka1 were grown at 37°C, while the ones harhar-boring pBADcLIC acka2 were grown at 37°C and 25°C. Upon induction for 2 h, the cells were harvested by centrifugation at 6,500⫻ g for 15 min and resuspended in 40 ml 50 mM KPi(pH 7) with 1 mM PMSF. Bacteria were disrupted in a Constant Systems TS apparatus (Biosystems) after addition of 1 mM magnesium sulfate and 0.1 mg/ml RNase/DNase to the resus-pended cells. To the crude lysate, 5 mM EDTA was added. The lysate was centrifuged at 15,000⫻ g for 15 min (4°C), and the supernatant was used for purification of the enzymes. Affinity chromatography was carried out at 4°C. The cell extract (⬃25 mg of total protein) was applied to a column containing a 500-l bed volume. Ni-Sepharose equilibrated with 50 mM KPi(pH 7) and 150 mM NaCl. Columns were washed with 20 ml of equilibration buffer with 10 mM imidazole. Enzymes were eluted by an imidazole gradient from 50 to 500 mM in 50 mM KPi(pH 7) plus 150 mM NaCl. Samples from each step were collected and analyzed by SDS-PAGE. Fractions with the highest ACK concentrations were applied to a Superdex 200 10/300GL gel filtration column (GE Healthcare) and eluted at a flow rate of 0.4 ml/min with 50 mM KPi(pH 7) plus 150 mM NaCl by using an Agilent 1200 series isocratic pump at 4°C. The oligomeric states of AckA1 and AckA2 were determined by size exclusion chromatography coupled to multiangle laser light scattering (SEC-MALLS) as described before (26, 27). A 200-l aliquot (150 g) of purified protein was used in the exper-iment.
FIG 1 Schematic representation of glucose catabolism in L. lactis MG1363.
TABLE 1 Primer sequences used for cloning of acka1 and acka2 in
pBADcLIC and pBADnLIC
Primer (plasmid) Sequence (5=–3=)
AckA1 Forward (pBADnLIC) ATGGTGAGAATTTATATTTTCAAGGTATGACCA AAACATTAGCAGTAAAC
AckA1 Reverse (pBADnLIC) TGGGAGGGTGGGATTTTCATTATTTTTTAAGT GCCTCAACGTCGCGAGC
AckA1 Forward (pBADcLIC) ATGGGTGGTGGATTTGCTATGACCAAAACAT TAGCAGTAAAC
AckA1 Reverse (pBADcLIC) TTGGAAGTATAAATTTTCTTTTTTAAGTGCC TCAACGTCGCGAGC
AckA2 Forward (pBADnLIC) ATGGTGAGAATTTATATTTTCAAGGTATGG AAAAAACGCTCGCTGTC
AckA2 Reverse (pBADnLIC) TGGGAGGGTGGGATTTTCATTATTTAGCC GCTTCGACATCACG
AckA2 Forward (pBADcLIC) ATGGGTGGTGGATTTGCTATGGAAAAAA CGCTCGCTGTC
AckA2 Reverse (pBADcLIC) TTGGAAGTATAAATTTTCTTTAGCCGCTTCGA CATCACG
The method described by Wen et al. was used to estimate the molec-ular masses of the native complexes (28). The weight-average molecular weight (Mw) of the protein was calculated using the classical Rayleigh relationship (29):⌬LS ⫽ (I/I0)solution⫺ (I/I0)buffer⫽ K(dn/dc)2· Mw⫻ C, where⌬LS is the excess of light scattered at a given angle by the solution containing the protein and compared to that of the buffer with-out the protein. I/I0is the ratio of the intensities of the light scattered at angle and the incident light. Mwis the weight-average molecular weight of the scattering protein. C is the concentration of the protein (in mg/ml), which was directly measured using a concentration-sensitive detector. dn/dc is the change in the refractive index of the solution with respect to the protein concentration.
K is a constant that depends on the refractive index of the solution without macromolecule (n), the wavelength of the light used (0), the angle between the incident and scattered light (), and the distance be-tween the scattering molecule and the detector (r), and it is calculated as follows: K⫽ 22n2/
04NA/[(1⫹ cos2)/r2)], where NAis Avogadro’s number.
Protein concentration determinations. The concentrations of AckA1
and AckA2 were determined by using a NanoDrop device, with extinction coefficients (ε) calculated on the basis of the amino acid composition of the proteins. The extinction coefficients of AckA1 and AckA2 were 28,880 M⫺1cm⫺1and 27,390 M⫺1cm⫺1, respectively.
Enzyme assays. Enzyme assays were carried out at 30°C. For the
reac-tion in the direcreac-tion of ATP and acetate formareac-tion, the assay mixture consisted of potassium-HEPES (pH 7.5; 0.1 M), potassium phosphate tribasic (1 mM), sodium chloride (50 mM), magnesium sulfate heptahy-drate (5 mM), hexokinase (2.5 U), glucose-6-phosphate-dehydrogenase (2.3 U), glucose anhydrate (2 mM), ADP (3 mM), NADP⫹(0.4 mM), and acetyl phosphate (5 mM), unless specified differently (i.e., addition of glycolytic intermediates). Reactions were performed in a total volume of 300l (SynergyMx plate reader; BioTek). The reaction was initiated with 30l of 0.05 M acetyl phosphate or 18 l of 50 mM ADP. For the enzy-matic reaction in the direction of acetyl phosphate formation, the assay mixture consisted of potassium-HEPES (pH 7.5; 0.1 M), potassium phos-phate tribasic (1 mM), sodium chloride (50 mM), 4.2 mM magnesium chloride, 1.7 mM phospho-enol-pyruvate (PEP), 0.24 mM NADH, 10 units of PK/LDH cocktail (Sigma), and various amounts of ATP and ac-etate. The coupled enzyme assay was performed as described by Goel et al. (30). The substrate concentrations and rates were fit to the Michaelis-Menten equation or to the following modified form: V⫽ (Vmax· X)/ [Km⫹ X · (1 ⫹ X/Ki)], using GraphPad Prism 5 to estimate the Km, Ki, and Vmaxvalues. The effect of crowding was tested by adding polyethylene glycol (PEG) 6000, PEG 4000, PEG 1500, or PEG 200 at a concentration of 0 to 10% (wt/vol) to the assay mixture.
RESULTS
Overexpression, purification, and oligomeric state. The two
isozymes of acetate kinase in L. lactis, acka1 and acka2, were sep-arately cloned and overexpressed in E. coli. The acka1 and acka2 genes from L. lactis subsp. cremoris MG1363 were inserted into the SwaI restriction digestion site of pBadNlic and pBadClic. Using these plasmids, the recombinant expression of acka1 and acka2 resulted in translation products with a 10-His tag at either the N or C terminus of the protein; the synthesis was under the control of theL-arabinose promoter. The expression levels of both enzymes were tested at two different temperatures (25°C and 37°C) and with three different concentrations ofL-arabinose (0.01, 0.001, and 0.0001% [wt/vol]). Both proteins were expressed well when induced with 0.01% (wt/vol)L-arabinose at 37°C. In general, the C-terminal-tagged version was expressed at a higher level than the N-terminal one (data not shown), and hence C-terminal-His-tagged ACKs were used for most experiments.
Purification of AckA1 and AckA2 was carried by using
Ni-Sepharose affinity chromatography, and the proteins were eluted in three fractions (Fig. 2BandD, lanes 1, 2, and 3). To further purify the proteins, elution fraction 2 was subjected to SEC, and the resultant protein fractions are indicated inFig. 2BandD, lanes 4. The 2-step-purified protein was used for further characteriza-tion, as described below. The yield from 1 liter of cell culture at an OD600of 2.5 was 3 to 4 mg of protein for both AckA1 and AckA2.
To determine the oligomeric states of AckA1 and AckA2, the pro-teins were subjected to SEC-MALLS. The SEC-MALLS profiles are shown inFig. 2AandC. The molecular mass of each peak in the static light-scattering analysis was calculated as described in Ma-terials and Methods. The molecular mass profiles of both AckA1 and AckA2 showed a relatively homogenous distribution around 13 ml, which corresponded to a molecular mass of 93 kDa. Since the calculated molecular mass of both proteins was 43 kDa, the native enzyme complexes are dimeric.
Enzymatic activity. The activity of acetate kinase for the catalytic
generation of ATP has been determined in a crude cell lysate in which contributions from AckA1 and AckA2 and possibly other enzymes could not be discriminated (12). We determined the activities of the purified enzymes in media mimicking the interior of the cell in terms of pH and ion composition but low in (macro)molecular crowding. For the ATP generation reaction, AckA1 was an order of magnitude more active than AckA2 (Fig. 3). We also mixed the two enzymes in different ratios (AckA1:AckA2), viz., 1:1, 1:4, and 4:1, to determine whether in solution they would possibly form heterodimeric com-plexes or influence each other via higher-order complex formation. In all the cases where a combination of the two enzymes was used, the combined activity was equal to the sum of the individual activities (Fig. 3).
FIG 2 (A and C) Static light-scattering profiles of AckA1 (A) and AckA2 (C).
The gray lines in each panel indicate the molecular mass. (B and D) SDS–10% PAGE analysis of AckA1 (B) and AckA2 (D). Lanes 1, 2 and 3, elution fractions after Ni-Sepharose purification; lane 4, peak fraction after SEC.
Acetate kinase catalyzes the transfer of phosphate from acetyl phosphate to ADP to form ATP and acetate. We thus determined the Kmand Vmaxvalues as a function of the concentrations of
acetyl phosphate and ADP. The kinetic parameters for acetyl phosphate were determined by initiating the reaction with ADP and vice versa. At an ADP concentration of 3 mM, the Kmvalues of
AckA1 and AckA2 for acetyl phosphate were nearly identical, with values of 0.54 mM and 0.55 mM, respectively (Fig. 4AtoD); these data are summarized inTable 2. The maximum velocity of AckA1 was about an order of magnitude higher than that of AckA2. The turnover numbers (kcat) of AckA1 and AckA2 were 1,100 and 100
s⫺1, respectively (Table 2).
By varying the ADP concentration and keeping acetyl phos-phate at 5 mM, we obtained activities that leveled off around 2 mM; above this concentration, both enzymes were inhibited, which is indicative of substrate inhibition (Fig. 4CandD). Be-cause of the non-Michaelis-Menten kinetics, the data were fit to an equation that took into account substrate inhibition: V⫽ Vmax·
X/[Km⫹ X · (1 ⫹ X/Ki)], in which Km, Ki, and Vmaxcorrespond to
the affinity constant for X (here, ADP), the inhibition constant for X, and the maximal rate of the reaction, respectively. The Km
val-ues of AckA1 and AckA2 for ADP were 0.47 mM and 0.74 mM, respectively. The Ki(ADP) values of AckA1 and AckA2 were 2.4
and 3.9 mM, respectively (Table 2). The inhibition of the ACKs by ADP is relevant at a low growth rate and under conditions of energy starvation when the ADP concentrations are in the milli-molar range. In fast-growing cells, ADP concentrations are well below 1 mM (31). To assess whether or not the inhibition by ADP was due to chelation of magnesium ions, the activity of AckA1 was determined by varying the ADP concentration in the presence of 5 and 30 mM MgCl2. Under conditions of either magnesium or
ADP excess, AckA1 was inhibited by ADP at concentrations of⬎2 mM (Fig. 5).
L. lactis can assimilate acetate but cannot grow on acetate as the
sole energy/carbon source. We thus investigated the kinetic prop-erties of the two enzymes in the direction of acetyl phosphate formation. AckA1 also showed an order-of-magnitude-higher ac-tivity in the reaction for acetate plus ATP to acetyl phosphate plus ADP (Fig. 4EtoH). The Kmvalues for ATP were about 0.07 mM
for both enzymes. However, the Kmof AckA1 for acetate (20.5
mM) was 4- to 5-fold higher than that of AckA2 (4.9 mM). The
kinetic parameters for the reaction in the direction of acetyl phos-phate formation are summarized inTable 2.
Effect of crowding. The activities of enzymes in vitro can be
very different from those in vivo due to the high crowding condi-tions (excluded volume effects) in the cytoplasm (32). We tested the activity of AckA1 in the presence of various concentrations (from 0 to 10% [wt/vol]) of different-sized polyethylene glycols (PEG 200, 1500, 4000, and 6000) as crowding agents. PEGs can stabilize or destabilize a protein, depending on the size and con-centration of the PEG molecules (see Discussion). The specific activity of AckA1 decreased by 20 to 30% and plateaued at a con-centration of about 4% (wt/vol), irrespective of whether a low- or relatively high-molecular-weight PEG was used (Fig. 6). The effect of varying the concentrations of PEG 6000 was also tested on AckA2, which yielded a dependence similar to that of AckA1 (data not shown). We thus concluded that AckA1 and AckA2 are not particularly sensitive to crowding conditions.
Regulation of AckA1 and AckA2. FBP has been shown to
in-hibit acetate kinase activity in L. lactis lysate (7). We now report that FBP inhibits both AckA1 and AckA2. We tested FBP up to a concentration of 100 mM under conditions at which the enzymes are partially inhibited by ADP (3 mM) and saturated with acetyl phosphate (5 mM). For AckA1, the IC50(inhibitor concentration
at 50% activity) for FBP was 17 mM (Fig. 7AandB), while for AckA2 the IC50was 43 mM. In order to elucidate the mechanism
of the inhibition, we determined the activity of the enzyme at 0, 17, and 50 mM FBP. We observed a decrease in Vmaxwith increasing
FBP, while the Kmfor acetyl phosphate was not significantly
af-fected. This is consistent with a noncompetitive mode of enzyme inhibition (Fig. 8).
G3P and DHAP are formed upon cleavage of FBP. While DHAP had no effects on the activities of the acetate kinases (data not shown), G3P inhibited the activity of AckA1 with an IC50of 4
mM (Fig. 7CandD). The activity of AckA2 was much less affected by G3P, and only at nonphysiological concentrations, a maximum inhibition of 50% was observed. Phospho-enol-pyruvate, a down-stream intermediate of glycolysis, completely inhibited the activ-ity of both enzymes at concentrations above 30 mM. The IC50s of
PEP for AckA1 and AckA2 were 15 and 18 mM (Fig. 7EandF). Next, we investigated the inhibition of AckA1 by FBP, PEP, and G3P at ADP and acetyl phosphate concentrations near the Kms for
both substrates (about 0.5 mM). The IC50s for FBP, PEP, and G3P
remained unchanged, confirming that substrates do not influence the binding of inhibitors to the regulatory site on the enzyme.
DISCUSSION
ACKs catalyze the synthesis of ATP from acetyl phosphate and ADP, leading to the formation of acetate. The enzyme can be also used in the reverse reaction, but thermodynamically, the equilib-rium is toward ATP formation (21,33). L. lactis subsp. cremoris MG1363 is one among many bacteria that has two or more genes for ACK. All the active site residues described for ACK from
Methanosarcina thermophila (34) and S. enterica serovar Typhi-murium (35), whose crystal structures are known, are conserved in the two enzymes from L. lactis MG1363. The ACKs character-ized so far are oligomeric enzymes, and the majority form dimer complexes (including the enzymes from M. thermophile [34], S.
enterica serovar Typhimurium [18,35], and E. coli [18]). The en-zyme from Bacillus stearothermophilus has been described as homotetrameric (22). The kinetic parameters of the acetate
ki-FIG 3 Acetate kinase activity for the reaction involving ATP formation with
different ratios of AckA1 and AckA2, as indicated. The experimental (Exp) and calculated (Cal) values, assuming independent functioning of the enzymes, were plotted.
nases from S. enterica serovar Typhimurium (18,35), E. coli (18),
Clostridium acetobutylicum (44), and Thermotoga maritima (20) have been determined for both the forward and reverse reactions. The Kmfor acetate varies from 0.07 mM for the enzymes in E. coli
and S. enterica serovar Typhimurium to 73 mM for the enzyme from C. acetobutylicum. The Kmvalues for ATP vary from 0.37
mM (C. actetobutylicum) to 7 mM (S. enterica serovar Typhimu-rium). The Kmvalues for ADP and acetyl phosphate are below 1
mM for all described acetate kinases.
We determined the kinetic parameters of AckA1 and AckA2 for both directions of the reaction. The turnover number (kcat) of AckA1
was an order of magnitude higher than that of AckA2 in both reaction directions (Table 2), and both enzymes were inhibited by millimolar concentrations of ADP. The inhibition by ADP is relevant under con-ditions of slow growth or energy starvation, when ADP concentra-tions are in the millimolar range (about 5 mM) (36). The Kmvalues of
AckA1 and AckA2 for acetyl phosphate were nearly identical. How-ever, the Kmof AckA2 for acetate was 4- to 5-fold lower than that of FIG 4 Specific activities of AckA1 and AckA2 as a function of acetyl phosphate (A and B), ADP (C and D), acetate (E and F), and ATP (G and H) concentrations.
AckA1. This implies that the relative contribution to the formation of acetyl phosphate by AckA2 is highest at low acetate concentrations. Thus, while AckA1 is the preferred enzyme for ATP formation, the role of AckA2 is primarily in acetate assimilation and synthesis of acetyl phosphate. In a recent study, Weinert et al. (37) demonstrated increased acetylation of metabolic enzymes in E. coli when cells en-tered the stationary phase. The increased acetylation stems from the generation of acetyl phosphate (37,38). It is possible that the different catalytic efficiencies (kcat/Km) of AckA1 and AckA2 in the
forward and backward reactions tune the pools of acetyl phos-phate and thus protein acetylation and contribute to the meta-bolic shift in L. lactis.
The cell environment is crowded with molecules, such as pro-teins and nucleic acids (39,40). The activities of enzymes deter-mined in vitro can significantly differ from the actual activities inside a cell, owing to the high crowding and/or relatively low water activity of the cytoplasm. We thus determined the effects of PEGs as crowding agents on the activities of the ACKs. PEGs are artificial crowding agents that can alter the stability/conformation of proteins, depending on their molecular mass and concentra-tion. PEG molecules can have destabilizing or stabilizing effects on proteins. Destabilizing effects of PEG molecules originate from the Lifshitz electrodynamic interaction of the cosolvent molecules with proteins, and these are attractive forces regardless of the chain length of the PEG molecules (41,42). The stabilization of protein structures by PEG molecules is attributed to the steric excluded volume effects, which are caused by entropic forces of the PEG molecules. The larger the PEG molecule, the more the
attractive forces are overcome by the repulsive forces, i.e., the pro-tein destabilization by binding of PEG molecules is overcome by the excluded volume effects. Both AckA1 and AckA2 showed a decrease in activity of 20 to 30% at PEG concentrations of 4 to 10% (wt/vol). Since the effects of low- and high-molecular-weight PEGs were similar, we have no indications for stabilizing/activat-ing effects due to high concentrations of (macro)molecules.
FBP has been implicated in the regulation of L. lactis metabo-lism as an allosteric activator of lactate dehydrogenase (13) and an inhibitor of acetate kinase (12). We have now confirmed the inhi-bition of acetate kinase, and we found that both AckA1 and AckA2 are inhibited by FBP. The intracellular FBP concentration in L.
lactis cells grown on various sugars in batch culture can vary from
25 to 118 mM (8). Neves et al. estimated the intracellular FBP concentration at 50 mM during homolactic fermentation (43), a concentration at which the residual activities of AckA1 and AckA2 would be less than 20% and lactate dehydrogenase would be max-imally activated. This would indeed favor homolactic over mixed-acid fermentation. Intriguingly, we found that both acetate ki-nases were strongly inhibited by PEP, and the inhibition of AckA1 by G3P was more pronounced than that of AckA1; DHAP had no effect on either of the enzymes. In fact, in glucose- or lactose-metabolizing cells, the pools of G3P and DHAP were around 0.6 mM. In galactose-metabolizing cells, the pools of G3P and DHAP are even lower (8). We thus conclude that the inhibition of AckA1 by G3P is most likely not physiologically relevant. On the other hand, PEP caused inhibition of both ACKs, with IC50s of 15 and 18
mM for AckA1 and AckA2, respectively. In L. lactis cells grown on glucose or galactose, the concentration of PEP was 25 mM and 0.6 mM, respectively. Thus, at high growth rates in the presence of
TABLE 2 Affinity constants and activities of AckA1 and AckA2 in the direction of ATP plus acetate or of acetyl phosphate plus ADP formationa
Reaction direction and enzyme Kmb(mM) Kmc(mM) Ki(mM)
Vmax
(mol/min/mg) kcat(s⫺1)
Acetyl phosphate⫹ ADP ¡ acetate ⫹ ATP
AckA1 0.54⫾ 0.1 0.47⫾ 0.1 2.4⫾ 0.7 1,526⫾ 74 1,105⫾ 65
AckA2 0.55⫾ 0.1 0.74⫾ 0.2 3.9⫾ 1 129⫾ 5 93⫾ 6
Acetate⫹ ATP ¡ acetyl phosphate ⫹ ADP
AckA1 20.54⫾ 2.0 0.07⫾ 0.01 1,051⫾ 34 761⫾ 34
AckA2 4.9⫾ 0.6 0.07⫾ 0.01 111⫾ 2 80⫾ 5
a
The parameters (means⫾ standard errors of the means) were obtained after fitting the data to the Michaelis-Menten equation, with and without a component for substrate inhibition.
b
The Michaelis constant for the substrate (i.e., acetyl phosphate for the reaction in the direction of ATP production and acetate for the reaction in the reverse direction, producing ADP).
c
The Michaelis constant for ADP (for the reaction producing ATP) or for ATP (for the reaction in the reverse direction, producing ADP).
FIG 5 Effect of magnesium ion concentration on substrate inhibition of
AckA1 by ADP. , 5 mM magnesium chloride; , 30 mM magnesium chlo-ride.
FIG 6 Specific activities of AckA1 in the presence of various concentrations of
glucose, PEP may contribute significantly to the inhibition of ac-etate kinase, which would favor homolactic fermentation.
In conclusion, AckA1 is an order of magnitude more active than AckA2 in both reaction directions, but AckA2 has the highest affinity for acetate, which gives the enzyme a more prominent role
in the formation of acetyl phosphate at low substrate concentra-tions. We found that major glycolytic intermediates allosterically control the activities of AckA1 and AckA2. The reciprocal alloste-ric regulation of acetate kinases is a mechanism that can allow L.
lactis to switch almost instantaneously between homolactic and
mixed-acid fermentation, which occurs as a function of the avail-ability of quickly or slowly metabolized sugars.
ACKNOWLEDGMENTS
This work is supported by the Dutch Technology Foundation STW (grant 08080), which is part of the Netherlands Organization for Scientific Re-search (NWO).
We acknowledge the help of Dirk-Jan Slotboom with the SEC-MALLS measurements. B.P. is supported by an NWO-TOP GO subsidy (grant 700.10.53). B.P. is additionally supported by the Netherlands Proteomics Centre.
REFERENCES
1. Kleerebezemab M, Hols P, Hugenholtz J. 2000. Lactic acid bacteria as a cell factory: rerouting of carbon metabolism in Lactococcus lactis by met-abolic engineering. Enzyme Microb. Technol. 26:840 – 848.http://dx.doi .org/10.1016/S0141-0229(00)001802-0.
FIG 7 Effects of fructose-1,6-bisphosphate (A and B), glyceraldehyde-3-phosphate (C and D), and phospho-enol-pyruvate (E and F) on the specific activities of
AckA1 () and AckA2 ().
FIG 8 Specific activities of AckA1 with acetyl phosphate as the substrate, in the
2. Konings WN, Kuipers O, Kuipers OP, ‘t Veld JH (ed). 1999. Lactic acid bacteria: genetics, metabolism and applications. Springer, Dordrecht, Netherlands.
3. Sijpesteijn AK. 1970. Induction of cytochrome formation and stimula-tion of oxidative dissimilastimula-tion by hemin in Streptococcus lactis and Leu-conostoc mesenteroides. Antonie Van Leeuwenhoek 36:335–348. 4. Brooijmans R, de Vos WM, Hugenholtz J. 2009. Electron transport
chains of lactic acid bacteria: walking on crutches is part of their lifestyle. F1000 Biol. Rep. 1:34.http://dx.doi.org/10.3410/B1-34.
5. Brooijmans RJ, Poolman B, Schuurman-Wolters GK, de Vos WM,
Hugenholtz J. 2007. Generation of a membrane potential by Lactococcus lactis through aerobic electron transport. J. Bacteriol. 189:5203–5209. http://dx.doi.org/10.1128/JB.00361-07.
6. Yamamoto Y, Poyart C, Trieu-Cuot P, Lamberet G, Gruss A, Gaudu P. 2005. Respiration metabolism of group B Streptococcus is activated by envi-ronmental haem and quinone and contributes to virulence. Mol. Micro-biol. 56:525–534.http://dx.doi.org/10.1111/j.1365-2958.2005.04555.x. 7. Thomas TD, Ellwood DC, Longyear VM. 1979. Change from homo- to
heterolactic fermentation by Streptococcus lactis resulting from glucose limitation in anaerobic chemostat cultures. J. Bacteriol. 138:109 –117. 8. Garrigues C, Loubiere P, Lindley ND, Cocaign-Bousquet M. 1997.
Control of the shift from homolactic acid to mixed-acid fermentation in Lactococcus lactis: predominant role of the NADH/NAD⫹ratio. J. Bacte-riol. 179:5282–5287.
9. Thompson J. 1978. In vivo regulation of glycolysis and characterization of sugar: phosphotransferase systems in Streptococcus lactis. J. Bacteriol. 136: 465– 476.
10. Mason PW, Carbone DP, Cushman RA, Waggoner AS. 1981. The importance of inorganic phosphate in regulation of energy metabolism of Streptococcus lactis. J. Biol. Chem. 256:1861–1866.
11. Thompson J, Torchia DA. 1984. Use of31P nuclear magnetic resonance
spectroscopy and14C fluorography in studies of glycolysis and regulation
of pyruvate kinase in Streptococcus lactis. J. Bacteriol. 158:791– 800. 12. Lopez de Felipe F, Gaudu P. 2009. Multiple control of the acetate
path-way in Lactococcus lactis under aeration by catabolite repression and me-tabolites. Appl. Microbiol. Biotechnol. 82:1115–1122.http://dx.doi.org /10.1007/s00253-009-1897-8.
13. Fordyce AM, Crow VL, Thomas TD. 1984. Regulation of product for-mation during glucose or lactose limitation in nongrowing cells of Strep-tococcus lactis. Appl. Environ. Microbiol. 48:332–337.
14. Melchiorsen CR, Jokumsen KV, Villadsen J, Johnsen MG, Israelsen H,
Arnau J. 2000. Synthesis and posttranslational regulation of pyruvate
formate-lyase in Lactococcus lactis. J. Bacteriol. 182:4783– 4788.http://dx .doi.org/10.1128/JB.182.17.4783-4788.2000.
15. Even S, Garrigues C, Loubiere P, Lindley ND, Cocaign-Bousquet M. 1999. Pyruvate metabolism in Lactococcus lactis is dependent upon glyc-eraldehyde-3-phosphate dehydrogenase activity. Metab. Eng. 1:198 –205. 16. Melchiorsen CR, Jokumsen KV, Villadsen J, Israelsen H, Arnau J. 2002. The level of pyruvate-formate lyase controls the shift from homolactic to mixed-acid product formation in Lactococcus lactis. Appl. Microbiol. Bio-technol. 58:338 –344.http://dx.doi.org/10.1007/s00253-001-0892-5. 17. Neves AR, Pool WA, Kok J, Kuipers OP, Santos H. 2005. Overview on
sugar metabolism and its control in Lactococcus lactis: the input from in vivo NMR. FEMS Microbiol. Rev. 29:531–554.http://dx.doi.org/10.1016 /j.femsre.2005.04.005.
18. Fox DK, Roseman S. 1986. Isolation and characterization of homoge-neous acetate kinase from Salmonella typhimurium and Escherichia coli. J. Biol. Chem. 261:13487–13497.
19. Aceti DJ, Ferry JG. 1988. Purification and characterization of acetate kinase from acetate-grown Methanosarcina thermophila. Evidence for reg-ulation of synthesis. J. Biol. Chem. 263:15444 –15448.
20. Bock AK, Glasemacher J, Schmidt R, Schönheit P. 1999. Purification and characterization of two extremely thermostable enzymes, phosphate acetyltransferase and acetate kinase, from the hyperthermophilic eubacte-rium Thermotoga maritima. J. Bacteriol. 181:1861–1867.
21. Spector LB. 1980. Acetate kinase: a triple-displacement enzyme. Proc. Natl. Acad. Sci. U. S. A. 77:2626 –2630.
22. Suzuki K, Nakajima H, Imahori K. 1982. Acetate kinase from Bacillus stearothermophilus. Methods Enzymol. 90:179 –185.
23. Geertsma ER, Poolman B. 2010. Production of membrane proteins in Escherichia coli and Lactococcus lactic. Methods Mol. Biol. 601:17–38. http://dx.doi.org/10.1007/978-1-60761-644-2_2.
24. Geertsma ER, Poolman B. 2007. High-throughput cloning and
expres-sion in recalcitrant bacteria. Nat. Methods 4:705–707.http://dx.doi.org /10.1038/nmeth1073.
25. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a labora-tory manual, 2nd ed. Cold Spring Harbor Laboralabora-tory Press, Cold Spring Harbor, NY.
26. Slotboom DJ, Duurkens RH, Olieman K, Erkens GB. 2008. Static light scattering to characterize membrane proteins in detergent solution. Meth-ods 46:73– 82.http://dx.doi.org/10.1016/j.ymeth.2008.06.012.
27. Erkens GB, Slotboom DJ. 2010. Biochemical characterization of ThiT from Lactococcus lactis: a thiamin transporter with picomolar substrate binding affinity. Biochemistry 49:3203–3212.http://dx.doi.org/10.1021 /bi100154r.
28. Wen J, Arakawa T, Philo JS. 1996. Size-exclusion chromatography with on-line light-scattering, absorbance, and refractive index detectors for studying proteins and their interactions. Anal. Biochem. 240:155–166. 29. Sun SF. 2004. Physical chemistry of macromolecules. John Wiley & Sons,
Hoboken, NJ.
30. Goel A, Santos F, de Vos WM, Teusink B, Molenaar D. 2012. Standard-ized assay medium to measure Lactococcus lactis enzyme activities while mimicking intracellular conditions. Appl. Environ. Microbiol. 78:134 – 143.http://dx.doi.org/10.1128/AEM.05276-11.
31. Konings WN, Poolman B, Driessen AJ. 1989. Bioenergetics and solute transport in lactococci. Crit. Rev. Microbiol. 16:419 – 476.
32. Norris MGS, Malys N. 2011. What is the true enzyme kinetics in the biological system? An investigation of macromolecular crowding effect upon enzyme kinetics of glucose-6-phosphate dehydrogenase. Biochem. Biophys. Res. Commun. 405:388 –392.http://dx.doi.org/10.1016/j.bbrc .2011.01.037.
33. Briggs PJ, Satchel DPN, White GF. 1970. Acylation. Part XXX. Metal ion catalysed hydrolysis of acetyl phosphate. J. Chem. Soc. B Phys. Org. 1970: 1008 –1012.http://dx.doi.org/10.1039/J29700001008.
34. Buss KA, Ingram-Smith C, Ferry JG, Sanders DA, Hasson MS. 1997. Crystallization of acetate kinase from Methanosarcina thermophila and prediction of its fold. Protein Sci. 6:2659 –2662.
35. Chittori S, Savithri HS, Murthy MRN. 2012. Structural and mechanistic investigations on Salmonella typhimurium acetate kinase (AckA): identi-fication of a putative ligand binding pocket at the dimeric interface. BMC Struct. Biol. 12:24 –24.http://dx.doi.org/10.1186/1472-6807-12-24. 36. Palmfeldt J, Paese M, Hahn-Hägerdal B, van Niel EWJ. 2004. The pool
of ADP and ATP regulates anaerobic product formation in resting cells of Lactococcus lactis. Appl. Environ. Microbiol. 70:5477–5484.http://dx.doi .org/10.1128/AEM.70.9.5477-5484.2004.
37. Weinert BT, Iesmantavicius V, Wagner SA, Schölz C, Gummesson B,
Beli P, Nyström T, Choudhary C. 2013. Acetyl-phosphate is a critical
determinant of lysine acetylation in E. coli. Mol. Cell 51:265–272.http://dx .doi.org/10.1016/j.molcel.2013.06.003.
38. Verdin E, Ott M. 2013. Acetylphosphate: a novel link between lysine acetylation and intermediary metabolism in bacteria. Mol. Cell 51:132– 134.http://dx.doi.org/10.1016/j.molcel.2013.07.006.
39. Mika JT, Poolman B. 2011. Macromolecule diffusion and confinement in prokaryotic cells. Curr. Opin. Biotechnol. 22:117–126.http://dx.doi.org /10.1016/j.copbio.2010.09.009.
40. Mika JT, van den Bogaart G, Veenhoff L, Krasnikov V, Poolman B. 2010. Molecular sieving properties of the cytoplasm of Escherichia coli and consequences of osmotic stress. Mol. Microbiol. 77:200 –207.http: //dx.doi.org/10.1111/j.1365-2958.2010.07201.x.
41. Karasawa A, Swier LJYM, Stuart MCA, Brouwers J, Helms B, Poolman
B. 2013. Physicochemical factors controlling the activity and energy
cou-pling of an ionic strength-gated ABC transporter. J. Biol. Chem. 288: 29862–29871.http://dx.doi.org/10.1074/jbc.M113.499327.
42. Damodaran SS. 2012. On the molecular mechanism of stabilization of proteins by cosolvents: role of Lifshitz electrodynamic forces. Langmuir
28:9475–9486.http://dx.doi.org/10.1021/la300953n.
43. Neves AR, Ventura R, Mansour N, Shearman C, Gasson MJ, Maycock
C, Ramos A, Santos H. 2002. Is the glycolytic flux in Lactococcus lactis
primarily controlled by the redox charge? Kinetics of NAD(⫹) and NADH pools determined in vivo by13C NMR. J. Biol. Chem. 277:28088 –28098. http://dx.doi.org/10.1074/jbc.M202573200.
44. Winzer K, Lorenz K, Durre P. 1997. Acetate kinase from Clostridium acetobutylicum: a highly specific enzyme that is actively transcribed dur-ing acidogenesis and solventogenesis. Microbiology 143:3279 –3286.http: //dx.doi.org/10.1099/00221287-143-10-3279.
