FOLIA POMERANAE UNIVERSITATIS TECHNOLOGIAE STETINENSIS Folia Pomer. Univ. Technol. Stetin., Agric., Aliment., Pisc., Zootech. 2017, 338(44)4, 205–216
Stefan STOJAŁOWSKI1, Monika HANEK1,2, Marta ORŁOWSKA1,
Martyna SOBCZYK1
DArT MARKERS LINKED WITH GENES CONTROLLING RESTORATION OF MALE FERTILITY IN HYBRID RYE CULTIVARS WITH IMPROVED POLLEN SHEDDING
MARKERY DArT SPRZĘŻONE Z GENAMI KONTROLUJĄCYMI PRZYWRACANIE MĘSKIEJ PŁODNOŚCI W ODMIANACH
MIESZAŃCOWYCH ŻYTA O POPRAWIONEJ ZDOLNOŚCI PYLENIA
1Department of Plant Genetics, Breeding and Biotechnology, West Pomeranian University of Technology, Szczecin, Poland
2DANKO Plant Breeding Ltd., Choryń, Poland
Streszczenie. Celem pracy było użycie wysokoprzepustowej technologii genotypowania do
zlokalizowania genów odpowiedzialnych za przywracanie męskiej płodności w odmianie mieszańcowej żyta zawierającej sterylizującą cytoplazmę Pampa. Metodę Diversity Arrays Technology (DArT) zastosowano do analiz w obrębie 48 osobników populacji F2 otrzymanej w wyniku krzyżowania pomiędzy męskosterylną linią S305P a losowo wybraną rośliną odmiany Gonello F1. Analizy DArT były uzupełnione dostępnymi w literaturze markerami opartymi na metodzie PCR, związanymi z przywracaniem płodności w CMS-Pampa lub alternatywnymi źródłami CMS żyta. Ogółem do genotypowania użyto ponad 3300 markerów. Skonstruowana mapa genetyczna obejmowała siedem grup sprzężeń zawierających łącznie 763 markery i pokrywała obszar ok. 520 cM. Osiemdziesiąt markerów molekularnych wykazywało statystycznie istotny związek z przywracaniem płodności w badanej populacji. Ich rozmieszczenie wskazuje na dwa regiony genomu istotne dla przywracania płodności – chromosom 4RL z silnym genem restorerowym oraz 1R z genem o mniejszym efekcie fenotypowym. Lokalizacje te okazały się zgodne z wcześniejszymi danymi literaturowymi. Nowe markery molekularne z tych obszarów, istotnie związane z przywracaniem płodności, zostały zidentyfikowane. Między nimi znajdują się markery oparte na PCR, ale otrzymane w wyniku konwersji z markerów DArT.
Key words: cytoplasmic male sterility, hybrid cultivars, restorer genes, rye.
Słowa kluczowe: cytoplazmatyczna męska sterylność, geny przywracania płodności, odmiany
mieszańcowe, żyto.
INTRODUCTION
Rye hybrid cultivars have been grown in Europe for more than 30 years. Almost all those cultivars are produced based on the cytoplasmic male sterility Pampa system (CMS-Pampa) discovered by Geiger and Schnell (1970) in the population of Argentinian rye. In European
Corresponding author – Autor do korespondencji: Stefan Stojałowski, Department of Plant Genetics, Breeding and Biotechnology, West Pomeranian University of Technology, Szczecin, Poland, e-mail: sstojalowski@zut.edu.pl
206 S. Stojałowski et al.
rye populations, a majority of genotypes maintain male sterility in hybrids with the Pampa cytoplasm, however they lack efficient restorer genes (Geiger and Miedaner 1996). A genetic mechanism of the male fertility restoration in CMS-P in European rye resources is complex and depends on the activity of several loci located on chromosomes 1R, 3R, 4R, 5R, and 6R (Miedaner et al. 2000). However, it was found that the highly effective restorer gene from the primitive Iranian rye population (Geiger and Miedaner 1996) localized in the Rfp1 locus on the long arm of the 4R chromosome (Miedaner et al. 2000) can effectively supplement the male fertility restoration in the CMS-P rye hybrid. The development of PCR-based sequence characterized amplified region (SCAR) molecular markers tightly linked with the Rfp1 gene (Stracke et al. 2003) allowed a relatively fast and precise transfer of this gene from the primitive IRAN IX rye population to advanced European breeding lines through the marker-assisted backcrossing (MAB) method. Consequently, in the last decade, hybrid cultivars based on the CMS-P system with significantly increased pollen shedding efficiency were successfully registered in Germany, Poland, and other countries. The breeding company KWS (Einbeck, Germany) developed and subsequently introduced cultivars containing the Rfp1 gene under the PollenPlus® trademark (Żyto ozime, http://www.kws-zboza.pl/en/ /odmiany/wszystkie-odmiany/zboze/zyto-ozime.html). The main advantage of PollenPlus® cultivars is their significantly reduced sensitivity to the ergot (Claviceps purpurea) infection as compared to other rye hybrids containing the CMS-P system.
Recently, several high-throughput genotyping methods significantly accelerating genetic analyses of numerous crops were developed. Among them, the diversity arrays technology (DArT) was successfully applied in rye research (Bolibok-Brągoszewska et al. 2009; Milczarski et al. 2011; Stojałowski et al. 2011, 2015; Myśków et al. 2014; Gawroński et al. 2016; Myśków and Stojałowski 2016). Therefore, in this study we applied the DArT technology to verify the Rfp1 gene efficacy in restoration of male fertility in PollenPlus® cultivars. We were interested whether the high level of pollen shedding results only from the presence of Rfp1 or other minor restorer genes are also required to restore male fertility in these cultivars.
MATERIAL AND METHODS
Twenty-seven individual plants originating from two PollenPlus® cultivars (Visello F1 and Gonello F1) registered by KWS (Einbeck, Germany) were phenotyped in 2010 in a glasshouse of the West Pomeranian University of Technology in Szczecin. The assessment of male fertility/sterility was performed by visual observations using a bonitation scale developed by Geiger and Morgenstern (1975). To verify data obtained from a visual assessment, the main ear of each plant was bagged before flowering, and after harvesting, the seed setting was analyzed additionally. During flowering, pollen collected from non-isolated ears of the one randomly chosen individual showing high male fertility (Gonello 249-1) was used for crosses with a male sterile inbred line.
As a maternal component of the mapping population, the male-sterile inbred line S305P provided by Danko Plant Breeding Ltd. (Choryń, Poland) was used.
Subsequently, a fully male fertile F1 plant was selfed in order to develop the F2 mapping population. This population was phenotyped in two vegetation seasons (2012 and 2015) under field conditions on plots of an experimental station of the West Pomeranian University
DArT markers linked with genes… 207
of Technology, Szczecin. Individuals were planted separately in 25 cm × 25 cm intervals. In total, 289 individuals were phenotyped. The male fertility of plants was assessed visually according to the Geiger and Morgenstern (1975). Results were verified by analyzing the seed setting under bags. In 2012, the main ear of each plant was isolated before flowering, whereas in 2015 three ears were bagged. The consistency of these two methods used for the evaluation of male sterility/fertility was estimated by calculating the correlation coefficients.
DNA of each individual of the mapping population was extracted from leaves collected at the beginning of the shooting phase. In total, 48 individuals revealing strong sterility and high male fertility (assessment confirmed by both methods of phenotyping) were selected for genotyping. DNA from selected F2 plants and parental lines was isolated using the Gene Elute Plant DNA Mini Kit (Sigma-Aldrich). Genotyping was performed using DArT provided as a service by DArT P/L (Australia) – Diversity Arrays Technology, http://www.diversityarrays.com. The high-throughput DArT genotyping was complemented by PCR-based markers from the 4RL chromosome reported in Stojałowski et al. (2011), Hackauf et al. (2012), and Milczarski et al. (2016). Seven PCR markers (Table 1) were developed on the bases of DArT sequences (Gawroński et al. 2016). During the conversion of DArT markers into PCR-based SCARs, the original marker prefix “XrPt” was replaced by “d,” whereas the related clone ID remained unchanged.
Table 1. Primer sequences of PCR markers developed on the basis of DNA sequences of DArT clones Tabela 1. Sekwencje starterów dla markerów PCR wytworzonych na podstawie sekwencji DNA klonów DArT Clone ID Numer klonu Forward sequence Starter F Reverse sequence Starter R 390763 CCATCTGCTAGGTCAGGCG ATGTACGATGGTTCACCACC 398695 GCAGCTTCCAGATTAGCCAT TGAATTCCTTTATTATAGCCTCCA 400382* GGTGCGCGGTCATCAGAAA CGGTGTGGACACACACATC 505904 AGAAAGTCATTGTCGGGGAA AGAAGTTAAAAACGTATTGCAAAT 508318 AGGGTCAAGCATGAAGACCTCT CTTACATGCGACGGTCGTGA 508573* GCAGCTTTAACACCAACACCT GGCCGTGCATGGTAGACAT 508800* GCGGTCATCAGAAAGGCTAGT TGCAACTTTACCAGCGAAGG * Reported by Milczarski et al. (2016) – Opisane w pracy Milczarski i in. (2016).
In order to identify a relationship between molecular markers and results of male fertility phenotyping, the Kruskal–Wallis (K–W) rank test was applied. Markers were considered to be significantly associated with the studied trait if p < 0.001. Data obtained from the molecular marker segregation analysis were used to construct the genetic map using the JoinMap 3.0 software (Van Ooijen and Voorrips 2001). Linkage groups were constructed at LOD = 4. Only two rounds of the mapping procedure were performed (the third round, optional in the software, was excluded.) Developed linkage maps were compared with the consensus genetic map of rye based on DArT markers (Milczarski et al. 2011) to assign them to particular chromosomes. Finally, the interval mapping (IM) procedure was performed using the MapQTL 5.0 package (Van Ooijen 2004). The putative localization of the gene/genes controlling male fertility restoration was considered when the LOD value exceeded 3.0. An additional threshold of significance for declaring the presence of the quantitative trait locus (QTL) was estimated by using a permutation test (at 1000 permutations).
208 S. Stojałowski et al.
RESULTS
A small sample size of both randomly chosen genotypes originating from two PollenPlus® cultivars were assessed for male fertility: 17 individuals of Visello F1 and 10 of Gonello F1. Although, high pollen shedding was observed in majority of examined plants, fully sterile individuals were also found in both hybrid varieties (Table 2).
Table 2. Number of plants classified as male sterile (MS) and male fertile (MF) within cultivars Visello F1 and Gonello F1 in glasshouse 2010
Tabela 2. Liczebność roślin ocenionych jako męskosterylne (MS) i męskopłodne (MP) w obrębie odmian Visello F1 i Gonello F1 rosnących w szklarni w 2010 r.
Cultivar – Odmiana MS MP Total – Razem
Visello F1 4 13 17
Gonello F1 1 9 10
The assessment of male sterility/fertility in the F2 mapping population of the cross [S305P × Gonello 249-1] revealed a bi-modal distribution of phenotypes (Table 3). Irrespectively of the year of the study, the most frequent phenotypes belonged to two classes: fully male sterile plants (classified in the Geiger and Morgenstern scale as 1–2) and fully male fertile ones (8–9 in the bonitation scale). Plants with partially restored male fertility were also present, however at a low number. Results of the visual observation of pollen shedding were highly consistent with those from the seed setting analysis–correlation coefficients in both years of the study (2012 and 2015) were estimated to be 0.88–0.89 (Table 3).
For genotyping, the set of 48 individuals was selected: 23 male sterile and 25 male fertile plants. Partly fertile individuals were not subjected to genotyping due to their uncertain assessment of the sterility/fertility class. For genotyping, individuals with fully consistent results of the visual assessment and seed setting were favored. Moreover, the correlation coefficient between both phenotyping methods was calculated to be 0.99 for selected groups (Table 3). The distribution of phenotypes studied in both years of study was significantly correlated. On the other hand, the calculated value of correlation coefficient: R = 0.48, indicates that the impact of environment on male fertility shouldn’t be skipped.
The DArT analysis provided the data for 3359 DArT markers. Among them, 1541 revealed polymorphism within the studied material (hybrid of the inbred line S305P and individual plant of the Gonello F1 cv.). These data were supported by results of the PCR analyses performed using previously mapped markers form the 4RL chromosome: two SCARs (Stojałowski et al. 2011), 25 conserved ortholog set (COS) (Hackauf et al. 2012), and 7 PCR markers developed from DArT sequences (Table 4). The application of the K–W test revealed 80 molecular markers significantly (at p < 0.001) associated with the male fertility restoration in studied plants. Among them, 75 were DArT markers, whereas remaining 5 were obtained by the PCR method (Table 4). Only one molecular marker, the COS marker TC 237550 developed by Hackauf et al. (2012) listed in the Table 4, revealed a co-dominant character. For 23 markers, the maternal allele was recorded in fully male-sterile plants. In contrast, the frequency of developed grains in the spikes of genotypes carrying the paternal allele of the markersexceeded 60% in all studied cases (Table 4).
DArT markers linked with genes… 209
Table 3. Phenotypic classification of the studied F2 population developed from the cross S305P x Gonello 249-1 Tabela 3. Wyniki fenotypowej oceny roślin populacji F2 otrzymanej z mieszańca S305P x Gonello 249-1
Population / subpopulation Populacja / część populacji
Classification in bonitation scale by Geiger and Morgenstern (1975)
Klasyfikacja wg skali bonitacyjnej Geigera i Morgensterna (1975) Total
Ogółem Correlaton Korelacja* 1 2 3 4 5 6 7 8 9 Phenotyped in 2012 Oceniona w 2012 25 05 3 1 4 2 7 94 062 203 0.89 Phenotyped in 2015 Oceniona w 2015 14 06 2 2 3 2 1 04 052 086 0.88 Total Ogółem 39 11 5 3 7 4 8 98 114 289
Selected for DArT analysis
Wybrana do analiz DArT 20 03 0 0 0 0 0 14 011 048 0.99
*Correlation coefficient between visual assessment of male fertility (using the scale suggested by Geiger and Morgenstern) and results of seed setting under bags – Współczynnik korelacji pomiędzy wynikami oceny wzrokowej pylenia (wykonanej wg skali Geigera i Morgensterna) a rezultatami oceny zawiązywania ziaren pod izolatorami.
210 S. Stojałowski et al.
Table 4. Molecular markers revealing in the Kruskal–Wallis (K–W) test significant association with seed setting in isolated spikes
Tabela 4. Markery molekularne wykazujące w teście Kruskala–Wallisa (K–W) istotny związek z wartościami zawiązywania ziaren pod izolatorami
Marker name Nazwa markera Chromosome Chromosom Positiona Pozycja K
Mean value of seed set for genotypes
Średnia wartość zawiązywania ziaren [%] dla genotypów A H B XrPt389352 nm 29.703*** 4.11 84.00 XrPt389599 4R 23.594*** 0.00 70.74 XrPt389669 4R 16.718*** 28.40 87.65 XrPt390550 nm 34.167*** 3.72 84.29 XrPt390649 4R 28.413*** 0.00 80.75 XrPt390719 4R 15.012** 30.07 87.71 XrPt390787 4R 220.5 23.594*** 0.00 70.74 XrPt398656 4R 34.524*** 3.72 84.29 XrPt398699 4R 229.8 33.902*** 3.72 84.16 XrPt398711 4R 220.5 22.03*** 0.00 70.18 XrPt398763 4R 220.5 23.12*** 0.00 70.18 XrPt399639 nm 13.54** 0.00 61.83 XrPt399841 4R 226.3 39.583*** 0.00 87.71 XrPt400308 4R 33.252*** 4.07 87.66 XrPt400310 nm 33.01*** 3.89 84.27 XrPt400433 4R 233.0 18.503*** 24.70 87.65 XrPt400484 4R 220.5 22.634*** 0.00 69.63 XrPt400996 4R 15.315*** 13.74 68.41 XrPt401048 4R 218.5 22.274*** 4.71 70.27 XrPt401070 4R 226.3 39.583*** 0.00 87.71 XrPt401183 4R 221.7 24.213*** 0.00 72.60 XrPt401280 4R 15.528*** 33.02 88.27 XrPt401308 4R 225.2 38.331*** 0.00 87.71 XrPt401353 4R 20.695*** 8.93 69.76 XrPt401544 4R 208.8 23.108*** 4.71 72.28 XrPt401589 4R 21.914*** 8.93 72.25 XrPt401955 4R 23.594*** 0.00 70.74 XrPt402157 4R 220.5 23.594*** 0.00 70.74 XrPt402159 4R 34.524*** 3.72 84.29 XrPt402193 4R 12.821** 35.38 88.76 XrPt402424 4R 18.68*** 8.93 67.48 XrPt410941 4R 31.906*** 0.00 87.75 XrPt411023 4R 220.5 22.137*** 0.00 68.92 XrPt411107 4R 229.5 31.845*** 3.72 88.34 XrPt411171 nm 10.907* 0.00 60.04 XrPt411281 4R 15.528*** 33.02 88.27 XrPt505207 4R 229.5 33.902*** 3.72 84.16 XrPt505229 4R 203.1 20.695*** 8.93 69.76 XrPt505244 4R 20.695*** 8.93 69.76 XrPt505417 4R 19.373*** 5.25 73.88 XrPt505440 4R 236.7 35.394*** 0.00 84.15 XrPt505760 4R 229.5 31.473*** 3.72 83.55 XrPt505904 4R 15.528*** 33.02 88.27 XrPt506089 4R 15.528*** 33.02 88.27 XrPt506146 4R 236.7 31.78*** 0.00 80.92 XrPt506330 4R 34.524*** 3.72 84.29 XrPt506444 4R 236.7 35.394*** 0.00 84.15 XrPt506508 4R 22.631*** 0.00 72.05 XrPt506618 4R 15.528*** 33.02 88.27 XrPt506686 4R 20.048*** 8.93 69.02 XrPt506696 4R 229.5 27.687*** 4.50 83.58 XrPt506829 4R 18.062*** 9.98 69.08 XrPt507289 4R 15.528*** 33.02 88.27 XrPt507549 4R 202.8 16.207*** 9.98 65.98
DArT markers linked with genes… 211
Table 4. Molecular markers revealing in the Kruskal–Wallis (K–W) test significant association with seed setting in isolated spikes (cont.)
Tabela 4. Markery molekularne wykazujące w teście Kruskala–Wallisa (K–W) istotny związek z wartościami zawiązywania ziaren pod izolatorami (cd.)
Marker name Nazwa markera Chromosome Chromosom Positiona Pozycja K
Mean value of seed set for genotypes
Średnia wartość zawiązywania ziaren [%] dla genotypów A H B XrPt507555 4R 15.447*** 26.35 87.42 XrPt507880 4R 18.205*** 25.43 87.65 XrPt508260 4R 21.062*** 0.00 67.99 XrPt508459 4R 202.8 18.375*** 9.98 69.23 XrPt508466 4R 202.8 20.695*** 8.93 69.76 XrPt508542 nm 11.501* 31.02 81.30 XrPt508638 4R 236.7 32.877*** 3.72 83.58 XrPt508693 4R 207.6 22.274*** 4.71 70.27 XrPt509165 4R 240.4 25.859*** 4.28 74.93 XrPt509188 4R 20.695*** 8.93 69.76 XrPt509241 1R 124.9 10.908* 7.23 61.25 XrPt509243 4R 203.1 20.695*** 8.93 69.76 XrPt509261 4R 225.5 18.411*** 26.42 88.27 XrPt509353 4R 202.8 20.695*** 8.93 69.76 XrPt509448 4R 202.8 20.695*** 8.93 69.76 XrPt509637 4R 220.5 20.024*** 0.00 68.87 XrPt6659 4R 15.502*** 28.40 87.38 XtPt6710 4R 19.475*** 22.70 87.65 XwPt4062 4R 20.202*** 5.37 76.74 XwPt6555 nm 24.363*** 13.72 87.82 XwPt7498 4R 11.323* 15.48 63.64 d390763 nm 31.549*** 3.89 81.05 d505904 4R 15.528*** 33.02 88.27 d508318 4R 39.583*** 0.00 87.71 TC237550 4R 26.771*** 4.28 69.22 81.30 Xscsz23L500 4R 23.705*** 22.48 88.00
a Cumulated position in cM of the marker on the consensus genetic map of RIL-S population by Milczarski et al. (2011) (no value – the marker was not located on the consensus map of RIL-S population) – Pozycja w cM na mapie konsensusowej dla populacji RIL-S wg Milczarskiego i in. (2011) (brak wartości – marker nie był zlokalizowany na mapie konsensusowej RIL-S).
K – value of K statistic (K–W test) – wartość statystyki K (test K–W); * significant at P < 0.001 – wartości istotne statystycznie przy P < 0,001; ** significant at P < 0.0005 – istotne przy P < 0,0005; *** significant at P < 0.0001 – istotne przy P < 0,0001.
Genotypes – Genotypy: A – maternal allele of the marker – allel pochodzący od formy matecznej mieszańca; B – paternal allele of the marker – allel pochodzenia ojcowskiego; H – heterozygote – heterozygota.
For dominant markers, where heterozygotes are not distinguishable from homozygotes of one parental form, values are printed in italics – Dla markerów dominujących, które nie pozwalają na odróżnienie heterozygot od homozygot jednej z form rodzicielskich, wartości średnie wyróżniono kursywą.
nm – not mapped on the genetic maps of RIL-S and [S305P × Gonello 249-1]F2 population (see Fig.1) – niezlokalizowane na mapach populacji RIL-S oraz populacji [S305P × Gonello 249-1]F2 (por. ryc. 1).
The linkage grouping performed in JoinMap 3.0 resulted in the construction of seven groups containing in total 994 markers (Table 5). These groups were assigned to respective chromosomes based on markers previously located on existing genetic maps of rye. Each linkage group consisted of 100–200 loci. Performed mapping analysis allowed localization of 763 markers on maps of linkage groups (Fig. 1, Table 5). Consequently, we obtained the genetic map of high density; an average distance between markers was estimated to be less than 0.7 cM. The total length of all 7 linkage maps was approximately 520 cM.
212 S. Stojałowski et al. 80 85 90 95 100 XrPt507254 XrPt410988 XrPt401887 XrPt508330 XrPt506629 XrPt506552 XrPt505309 XrPt507905 XrPt410836 XrPt506041 XrPt507167 XrPt509026 XrPt505353 XrPt506323 XrPt506657 XrPt402055 XrPt411098 XrPt9186 XrPt508210 XrPt402551 XrPt400087 XrPt507636 XrPt399840 XrPt505725 XrPt401531 XrPt509362 XrPt400103 XrPt508079 XrPt401292 XrPt401772 XrPt399771 XrPt400138 XrPt505839 XrPt389667 XwPt344173 XrPt402616 XrPt402248 XrPt398750 XrPt401704 XtPt1713 XrPt389984 XrPt508484 XrPt401396 XrPt505761 XrPt411285 XrPt509425 XrPt506349 XrPt509060 XrPt509453 XrPt507554 XrPt402212 XrPt507209 XrPt410970 XrPt509241 XrPt411018 XrPt400287 XrPt400399 XrPt506666 XrPt401246 XrPt508463 XrPt507839 XrPt400075 XrPt506074 XrPt507726 XrPt389448 XrPt3206 XrPt506070 XrPt399791 XrPt389678 XrPt399878 XrPt402339 XrPt505512 XrPt401566 XrPt507650 XrPt508455 XrPt507790 XrPt507193 XrPt411340 XrPt398851 XrPt398824 XrPt401003 XrPt505190 XwPt343877 XrPt509379 XtPt7559 XrPt398796 XrPt389469 XrPt509489 XrPt402536 XrPt506276 XrPt509417 XrPt508290 XrPt508421 XrPt507892 XrPt402410 XrPt402346 1R XrPt506621 XrPt508040 XrPt399788 XrPt402355 XrPt400997 XrPt506245 XrPt398791 XrPt390536 XrPt508322 XrPt411234 XrPt401329 XrPt401533 XrPt506926 XrPt8307 XrPt506176 XrPt400410 XrPt400224 XrPt506138 XrPt507282 XrPt390105 XrPt389562 XrPt508470 XrPt507367 XrPt411158 XrPt401997 XtPt0619 XrPt505625 XrPt389503 XrPt506732 XrPt508213 XrPt507875 XrPt400949 XrPt390224 XrPt400634 XrPt401844 XrPt506904 XrPt507183 XrPt398566 XrPt507117 XrPt411377 XrPt402236 XrPt509431 XrPt506827 XrPt389602 XrPt401315 XrPt506196 XwPt0271 XrPt401519 XrPt400854 XrPt509017 XrPt400975 XrPt401657 XrPt507298 XrPt1002 XrPt399784 XrPt389322 XrPt507952 XrPt410800 XrPt400417 XrPt505663 XrPt507665 XrPt3473 XrPt398612 XrPt505781 XrPt400806 XrPt400229 XrPt402474 XrPt506241 XrPt507837 XwPt6752 XrPt399821 XrPt2534 XrPt506635 XrPt389690 XrPt410889 XrPt506181 XrPt508253 XrPt411208 XrPt389972 XrPt399774 XtPt7975 XrPt506368 XrPt505263 XrPt505455 XrPt390789 XrPt505513 XrPt399876 2R XwPt344215 XrPt507374 XrPt507700 XrPt400393 XrPt508074 XrPt399481 XrPt507801 XrPt506455 XwPt5810 XwPt0053 XrPt508819 XwPt117212 XwPt4890 XrPt509727 XrPt398694 XwPt9817 XrPt509479 XrPt398622 XrPt505322 XrPt507377 XrPt505453 XrPt508234 XrPt508674 XrPt507210 XrPt507149 XtPt9049 XrPt399990 XrPt505183 XrPt508507 XrPt410966 XrPt402407 XrPt508029 XrPt400783 XwPt6821 XrPt506033 XrPt398703 XrPt509626 XrPt507150 XrPt505651 XrPt506463 XrPt400838 XrPt400964 XrPt505965 XrPt402359 XrPt401474 XrPt399578 XrPt507461 XrPt506785 XrPt402226 XrPt506905 XrPt505832 XrPt509159 XrPt508194 XrPt506967 XrPt508377 XrPt508069 XrPt505542 XrPt1959 XrPt389421 XrPt410818 XrPt400863 XrPt400480 XrPt401358 XrPt401359 XrPt506051 XrPt400630 XrPt398678 XrPt399275 XwPt5172 XrPt506188 XrPt0238 XrPt506425 XrPt505423 XrPt505640 XrPt399411 XrPt0857 XrPt411096 XrPt398784 XtPt3746 XrPt399944 XrPt507747 XrPt505144 XrPt505848 XrPt509495 XrPt509375 XrPt507246 XrPt389922 XrPt505280 XrPt508687 XrPt399666 XrPt508536 XrPt401327 XrPt411054 XrPt389313 XrPt505591 XrPt507877 XrPt506501 XrPt509519 XrPt509305 XrPt399402 XrPt509296 XrPt505215 XrPt506607 XrPt401576 XrPt400319 XwPt345759 XrPt508772 XwPt8530 XrPt508353 XtPt9414 XrPt508228 XrPt506999 3R XrPt400085 XrPt509077 XrPt505165 XrPt506007 XrPt508864 XrPt505477 XrPt506011 XrPt506117 XrPt507170 XrPt508519 XrPt509459 XrPt505782 XrPt509110 XrPt507855 XrPt505626 XrPt505774 XrPt506899 XrPt400825 XrPt390148 XrPt399656 XrPt505689 XrPt508932 XrPt401421 XrPt508381 XrPt402510 XtPt4576 XrPt389603 XrPt505881 XrPt505871 XrPt509552 XrPt402443 XrPt398633 XrPt401071 XrPt401663 XrPt399305 XrPt400525 XrPt508404 XrPt507095 XwPt0626 XrPt508577 XrPt399323 XrPt505596 XrPt402300 XrPt509173 XrPt508284 XwPt7428 XrPt508016 XrPt506606 XrPt507451 XrPt507812 XrPt507270 XrPt400820 XrPt400605 XrPt401169 XrPt509606 XrPt400130 XrPt398512 XrPt505775 XrPt506593 XrPt7906 XrPt6710 XrPt507109 XrPt401029 XwPt0654 XrPt509554 XrPt508585 XrPt6946 XwPt4130 XwPt9820 XrPt508350 XrPt506534 XrPt507738 XwPt7498 XwPt343920 XrPt410907 XrPt400747 XrPt506047 XrPt400996 XrPt389465 XrPt507549 XrPt402424 XrPt508459 XrPt506829 XrPt506686 XrPt509448 XrPt505229 XrPt509188 XrPt508466 XrPt505244 XrPt509243 XrPt509353 XrPt401353 XrPt401589 XrPt402193 XrPt401048 XrPt508693 XrPt401544 XrPt506508 XrPt401955 XrPt389599 XrPt508260 XrPt505417 XwPt4062 XrPt402157 XrPt390787 XrPt398763 XrPt400484 XrPt509637 XrPt411023 XrPt398711 XrPt401183 d505904 XrPt507289 XrPt505904 XrPt506618 XrPt411281 XrPt401280 XrPt506089 XrPt509261 XrPt410941 XtPt6710 XrPt401308 XrPt400433 XrPt389669 XrPt507880 XrPt6659 XrPt507555 XrPt390719 XrPt399841 XrPt401070 d508318 XrPt390649 XrPt506696 XrPt400308 XrPt505440 XrPt506444 XrPt506146 XrPt402159 XrPt506330 XrPt398656 XrPt509165 TC237550 Xscsz23L500 4R 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75
DArT markers linked with genes… 213
Fig. 1. Genetic map of rye chromosomes and localization of genomic regions determining male fertility restoration in the [S305P × Gonello 249-1]F2 population.
Markers underlined and printed in bold style were significant in the Kruskal–Wallis test P < 0.001)
Ryc. 1. Mapa genetyczna chromosomów żyta i lokalizacja regionów genomu kontrolujących przywracanie męskiej płodności u mieszańca [S305P × Gonello 249-1]F2.
Markery, których nazwy zostały podkreślone i wyróżnione pogrubioną czcionką wykazywały statystyczną istotność w teście Kruskala–Wallisa (P < 0,001)
intervals where LOD > 3.0 – przedziały z wartościami LOD 3.0
intervals where LOD significant in Permutation test – przedziały z wartościami LOD istotnymi w teście permutacji XrPt507354 XrPt509597 XrPt399581 XrPt509684 XrPt390306 XrPt400262 XrPt506005 XrPt506262 XrPt402675 XrPt402063 XrPt506055 XrPt398734 XrPt4269 XrPt410759 XrPt508269 XrPt505701 XrPt509607 XrPt508823 XrPt505818 XwPt3305 XrPt509067 XrPt507240 XrPt509400 XrPt505734 XrPt509193 XrPt401561 XrPt505446 XrPt505551 XrPt506901 XrPt509523 XrPt505490 XrPt505294 XrPt507148 XrPt508412 XrPt509611 XrPt509494 XrPt410767 XrPt402181 XrPt411231 XrPt508537 XtPt5060 XrPt506246 XrPt401500 XrPt390065 XrPt509456 XrPt399606 XrPt400748 XrPt402150 XrPt401055 XrPt507192 XrPt508103 XrPt507042 XrPt402461 XrPt401944 XrPt401463 XrPt6661 XrPt401688 XrPt506729 XrPt401780 XrPt508912 XrPt506860 XrPt402204 XrPt401093 XrPt402008 XrPt506747 XrPt390278 XrPt390527 XrPt507887 XrPt505220 XrPt507421 XrPt402391 XrPt507263 XrPt401705 XwPt344500 XrPt508110 XrPt400223 XrPt509413 XrPt508245 XrPt6165 XrPt390242 XrPt402257 XrPt402336 XrPt389759 XrPt411050 XrPt508201 XrPt507137 XrPt505561 XrPt398800 XrPt507953 XrPt402531 XrPt507366 XtPt1893 XtPt8896 XrPt507647 XrPt390603 XrPt507664 XrPt411469 XrPt401275 XrPt398807 XrPt509503 XrPt508834 XrPt509721 XwPt345687 XrPt508266 XrPt509507 5R XwPt3581 XwPt9881 XrPt401932 XrPt399340 XrPt505897 XrPt401305 XrPt508125 XrPt401965 XrPt505206 XrPt402229 XrPt411453 XwPt9934 XrPt390641 XwPt345979 XrPt507635 XrPt509183 XrPt508379 XrPt505711 XwPt9790 XrPt508824 XrPt506554 XrPt401941 XrPt400366 XrPt410850 XrPt410888 XrPt505604 XrPt508631 XrPt402304 XrPt509584 XwPt345966 XrPt509614 XrPt399945 XrPt389307 XrPt399916 XrPt399825 XrPt411161 XrPt508321 XrPt509333 XrPt509351 XrPt507589 XrPt401054 XrPt506099 XrPt506263 XrPt399879 XrPt507463 XrPt411086 XrPt400921 XwPt3915 XtPt7900 XrPt507032 XrPt401579 XrPt507299 XrPt399567 XrPt401638 XrPt506238 XrPt401449 XrPt506236 XrPt399352 XrPt389656 XrPt506462 XrPt400608 XrPt507821 XrPt505324 XrPt509395 XrPt508388 XrPt507834 XrPt506435 XrPt505383 XrPt389611 XrPt507631 XrPt399691 XrPt509143 XrPt507745 XrPt399388 XrPt411082 XrPt401254 XrPt399964 XrPt507521 XrPt399646 XrPt389344 XrPt400884 XrPt402544 XrPt506995 XrPt508128 XrPt402507 XrPt509665 XrPt507325 XrPt507397 XrPt507502 XrPt507715 XrPt401034 XrPt505860 XrPt389741 XrPt509167 XrPt507643 XrPt402672 XrPt505488 XrPt509440 XrPt390734 XrPt401199 XrPt506107 XrPt509271 XrPt390469 XrPt509463 XrPt508968 XrPt505447 XrPt507320 XrPt411510 XrPt508548 XrPt400935 XrPt508371 XrPt399452 XrPt389274 XrPt508737 XrPt390647 XrPt507536 XrPt505449 XrPt402416 XrPt507027 XrPt509003 6R XrPt506158 XrPt507398 XrPt402305 XwPt4898 XrPt507215 XrPt402454 XrPt401466 XrPt399845 XrPt508731 XrPt508541 XrPt399391 XrPt399848 XrPt507741 XrPt507262 XrPt509065 XrPt400572 XrPt399665 XrPt400261 XrPt506974 XrPt506930 XrPt509286 XrPt506023 XrPt390687 XrPt506960 XrPt508616 XrPt509401 XrPt7557 XrPt401443 XrPt398519 XrPt411276 XrPt507241 XrPt509317 XrPt402607 XrPt401795 XrPt508683 XrPt506902 XrPt505200 XrPt411254 XrPt401828 XrPt390593 XrPt506157 XrPt505213 XrPt402404 XwPt2532 XrPt400890 XrPt509730 XrPt509204 XrPt390613 XrPt399338 XrPt508579 XrPt400782 XrPt509108 XrPt401882 XrPt508293 XrPt509066 XrPt5504 XrPt508591 XrPt398831 XrPt507657 XrPt507754 XrPt400710 XrPt505785 XrPt509141 XrPt509140 XrPt401263 XrPt399654 XrPt505397 XrPt506256 XrPt508666 XrPt505678 XrPt401212 XrPt506949 XrPt410867 XrPt401240 XrPt390741 XrPt1961 XrPt398474 XrPt505375 XrPt507691 XrPt410977 XrPt389647 XrPt389256 XrPt8933 XrPt4750 XrPt507482 XrPt506568 XrPt8149 XrPt508907 XrPt402105 XrPt399361 XrPt399726 XrPt506110 XrPt509176 XrPt505437 XrPt401523 XrPt410913 XrPt398836 XrPt401912 XrPt402021 XrPt508868 7R 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 100
214 S. Stojałowski et al.
Table 5. Linkage groups (LG) of the [S305P x Gonello 249-1]F2 mapping population Tabela 5. Grupy sprzężeń (LG) w populacji mapującej [S305P x Gonello 249-1]F2
Chromosome Chromosom
Total number of markers within the LG
Ogólna liczba markerów w LG
Number of markers included into map
Liczba markerów wprowadzonych na mapę Total length Całkowita długość LG [cM] Average map densitya Średnia gęstość mapy 1R 141 096 063.3 0.66 2R 115 087 050.0 0.57 3R 148 112 063.2 0.56 4R 200 143 097.7 0.68 5R 113 105 071.5 0.68 6R 150 120 103.8 0.86 7R 127 100 070.1 0.70 Total Ogółem (1-7R) 994 763 519.6 0.68 cM – centiMorgan – centyMorgan.
a Length ofLG in cM per number of markers – Długość grupy sprzężeń (w cM) podzielona przez liczbę markerów.
The IM analysis performed to detect QTLs controlling the restoration of male fertility indicated importance of two genomic regions. First, a strong phenotypic effect was associated with the long arm of the chromosome 4R, whereas a moderate effect with the chromosome 1R (Fig. 1). The significance of the QTL detected on chromosome 4RL was confirmed by the permutation test. In both regions, markers indicated by the IM method and showing significance in the K–W test were mapped (Fig. 1).
DISCUSSION
Attempts to identify genes controlling the male fertility restoration in the cytoplasmic male sterility Pampa system were initiated relatively long time ago. In the first study performed by Wricke et al (1993), the restorer gene was localized on the chromosome 1R. Further, Miedaner et al (2000) analyzing three mapping population observed significant differences in the genetic control of male fertility restoration between European and exotic rye populations. In the European inbred line, the most efficient male fertility restorers were found on 1RS and 3RL chromosomes, whereas significantly stronger phenotypic effects were induced by genes from Iranian and South American populations. These genes (or possibly, only one gene present in different resources) were located on the chromosome 4RL. Subsequently, for the effective restorer gene (Rfp1) originating from the IRAN IX population, the set of PCR-based markers was developed (Stracke et al. 2003; Hackauf et al. 2012). This gene was introduced into advanced breeding materials through the MAB method, and subsequently allowed the development and registration of the PollenPlus® cultivars. In the light of these results, the association of the strongest phenotypic effect with the 4RL chromosome in the mapping population developed using the PollenPlus® cultivar had to be expected. This result confirmed the importance of the Rfp1 gene for the efficient pollen shedding in this cultivar. However, the low number of tested individuals used for genotyping did not allow the construction of the precise map. Considering this limitation, we decided to generate maps performing only two out of three rounds of mapping using JoinMap (Van Ooijen and Voorrips 2001). Markers included in the maps constructed during the first two rounds were located at a higher
DArT markers linked with genes… 215
significance. Further, this study resulted in the identification of the new set of DArT markers tightly linked with the Rfp1 gene. Three out of them converted into PCR-based markers, d390763, d505904, and d508318, can be applied to the breeding practice. Moreover, based on the suggestion that DArT makers are effective in targeting the gene space in rye genome (Gawroński et al. 2016 reported here frame maps can be further use for the development of more precise high-resolution maps, and subsequent cloning of the Rfp1 gene.
The identification of the moderate restorer gene on the 1R chromosome raised an interesting new question whether this gene can also play a significant role in the high pollen production in the Gonello F1 cultivar. The efficiency of Rfp1 seems to be very high, however our knowledge of the genomic control of the male fertility restoration in modern rye hybrid cultivars with the Pampa cytoplasm is still limited. Therefore, it remains difficult to predict whether in the studied cultivar additional restorer genes with moderate efficiency are necessary for pollen production and what their importance is.
RECAPITULATION
As stated earlier, the presence of the efficient Rfp1 gene from the chromosome 4RL, that restores male fertility in hybrid cultivars with the Pampa cytoplasm was confirmed. A set of DArT markers linked with this gene was identified for the first time. Three practically useful PCR-based makers obtained by conversion of DArT markers were reported. Moreover, the presence of the additional moderate restorer gene on the chromosome 1R was observed in the studied Gonello F1 cultivar.
REFERENCES
Bolibok-Brągoszewska H., Heller-Uszyńska K., Wenzl P., Uszyński G., Kilian A., Rakoczy- -Trojanowska M. 2009. DArT markers for the rye genome – genetic diversity and mapping. BMC
Genom. 10, 578.
Diversity Arrays Technology, http://www.diversityarrays.com, access: 31.03.2017.
Gawroński P., Pawełkowicz M., Tofil K., Uszyński G., Sharifova S., Ahluwalia S., Tyrka M., Wędzony M., Kilian A., Bolibok-Brągoszewska H. 2016. DArT markers effectively target gene
space in the rye genome. Front. Plant Sci. 7, 1600. DOI: 10.3389/fpls.2016.01600.
Geiger H.H., Miedaner T. 1996. Genetic basis and phenotypic stability of male-fertility restoration in
rye. Vortr Pflanzenzüchtg 35, 27–38.
Geiger H.H., Morgenstern K. 1975. Angewandt-genetische Studien zur cytoplasmatischen
Pollen-sterilität bei Winterroggen. Theor. Appl. Genet. 46, 269–276.
Geiger H.H., Schnell F.W. 1970. Cytoplasmatic male sterility in rye (Secale cereale L.). Crop. Sci. 10,
590–593.
Hackauf B., Korzun V., Wortmann H., Wilde P., Wehling P. 2012. Development of conserved
ortholog set markers linked to the restorer gene Rfp1 in rye. Mol Breeding 30, 1507–1518.
Miedaner T., Glass C., Dreyer F., Wilde P., Wortmann H., Geiger H.H. 2000. Mapping of genes for
male-fertility restoration in 'Pampa' CMS winter rye (Secale cereale L.). Theor. Appl. Genet. 101, 1226–1233.
Milczarski P., Bolibok-Brągoszewska H., Myśków B., Stojałowski S., Heller-Uszyńska K., Góralska M., Brągoszewski P., Uszyński G., Kilian A., Rakoczy-Trojanowska M. 2011. A high density consensus
map of rye (Secale cereale L.) based on DArT markers. PLoS ONE 6(12), e28495. DOI:10.1371/ /journal.pone.0028495.
216 S. Stojałowski et al.
Milczarski P., Hanek M., Tyrka M., Stojałowski S. 2016. The application of GBS markers for extending
the dense genetic map of rye (Secale cereale L.) and the localization of the Rfc1 gene restoring male fertility in plants with the C source of sterility-inducing cytoplasm. J. Appl. Genet. 57, 439–451.
Myśków B., Hanek M., Banek-Tabor A., Maciorowski R., Stojałowski S. 2014. The application of
high-density genetic maps of rye for the detection of QTLs controlling morphological traits. J. Appl. Genet. 55, 15–26.
Myśków B., Stojałowski S. 2016. Bidirectional selective genotyping approach for the identification of
quantitative trait loci controlling earliness per se in winter rye (Secale cereale L.). J. Appl. Genet. 57, 45–50.
Stojałowski S.A., Milczarski P., Hanek M., Bolibok-Brągoszewska H., Myśków B., Kilian A., Rakoczy- -Trojanowska M. 2011. DArT markers tightly linked with the Rfc1 gene controlling restoration of
male fertility in the CMS-C system in cultivated rye (Secale cereale L.). J. Appl. Genet. 52, 313–318.
Stojałowski S., Myśków B., Hanek M. 2015. Phenotypic effect and chromosomal localization of
Ddw3, the dominant dwarfing gene in rye (Secale cereale L.). Euphytica 201, 43–52.
Stracke S., Schilling A.G., Forster J., Weiss C., Glass C., Miedaner T., Geiger H.H. 2003.
Development of PCR-based markers linked to dominant genes for male-fertility restoration in Pampa CMS of rye (Secale cereale L.). Theor. Appl. Genet. 106, 1184–1190.
Van Ooijen J.W. 2004. MapQTL®5Software for the mapping of quantitative trait loci in experimental
populations. Wageningen, Netherlands, Kyazma B.V.
Van Ooijen J.W., Voorrips R.E. 2001. JoinMap® 3.0, Software for the calculation of genetic linkage
maps. Wageningen, Netherlands, Plant Research International.
Wricke G., Wilde P., Wehling P., Gieselmann C. 1993. An isozyme marker for pollen fertility restoration
to the Pampa cms system of rye (Secale cereale L.). Plant Breed 111, 290–294.
Żyto ozime, http://www.kws-zboza.pl/en/odmiany/wszystkie-odmiany/zboze/zyto-ozime.html, access:
31.03.2017. [in Polish]
Abstract. In this study, we aimed to apply a high-throughput genotyping method to map genes
important for the restoration of male fertility in a hybrid cultivar of rye containing the Pampa sterilizing cytoplasm. The diversity arrays technology (DArT) was used to analyse 48 individuals of the F2 population obtained by crossing the male-sterile S305P line with a plant randomly chosen in the Gonello F1 cultivar. In addition to DArT markers, a set of previously published PCR-based markers was also used for genotyping. In total, more than 3300 markers were used in this study. A mapping analysis allowed a construction of seven linkage groups containing 763 markers covering a total distance of approximately 520 cM. Eighty molecular markers were applied to identify genomic regions important for the male fertility restoration. Their distribution indicated the presence of a major and minor restorer genes on chromosomes 4RL and 1R, respectively. These results were consistent with previous reports on the genetic control of the male fertility in the CMS-Pampa. Moreover, new molecular markers located in chromosomal regions significantly associated with the restoration of male fertility were found as well, including PCR-based markers converted from the DArT markers.
This work was financially supported by Polish Ministry of Agriculture and Rural Development (project No. 20).
