Medycyna Wet. 2008, 64 (12) 1393
Praca oryginalna Original paper
Enzootic Bovine Leukosis (EBL) is a chronic in-fectious neoplastic disease. The etiologic agent of EBL is Bovine Leukemia Virus (BLV) of the family Retro-viridae. Infected animals are the primary source of the virus. BLV-positive lymphocytes, found in the milk and colostrum of affected cows, may be transmitted to offspring (8, 10). At the initial stage of infection, B lymphocytes are the primary cellular target since viral replication and integration into the host cell genome take place there (15). Next the virus spreads to T lym-phocytes, monocytes (11, 28) and other cells (3, 27). As a result of the integration of the viruss genetic material into the host genome, all BLV-positive ani-mals remain infected for life. In the majority of cases BLV infection is clinically silent such animals are referred to as aleukemic, and their lymphocyte counts remain within or below the normal range (9). Around 30% of BLV-infected animals develop persistent lym-phocytosis, accompanied by changes in morphology and B lymphocyte counts (4). Only 0.1 to 10% of cat-tle develop fatal lymphosarcoma (31). EBL is wide-spread in many parts of the world, and it causes major economic losses resulting from the culling of affected animals and the shortening of their lifespan, as well as from reduced milk production and impairment of
re-production (6, 25, 26). Disease control and eradica-tion programs rely on early deteceradica-tion followed by the elimination of carrier animals from the herd. Such programs have efficiently limited the spread of EBL in Poland and other European countries, but the virus itself has never been eliminated; therefore, BLV-posi-tive animals are still a potential source of infection (18). Epizootiological surveys carried out in Poland have revealed the spread of BLV within numerous herds in different regions of the country (33). EBL con-trol depends on laboratory tests enabling to determine the prevalence of BLV-infected animals and to eradi-cate the infection from the herd, as well as to protect young animals against BLV.
A variety of methods have been applied for diagno-sing EBL, but the problem of the presence of undetec-ted BLV carriers in the herd remains topical. The com-monly applied serological methods (ID and ELISA) involve the detection of antibodies against BLV in the serum of infected animals, but they do not always reveal all virus carriers (12, 21), because sometimes the levels of antibodies are too low to be detected by the above methods (21). A promising technique for the diagnosis of EBL is PCR (polymerase chain reac-tion). This rapid and highly sensitive technique per-mits the detection of the viruss genetic material in a large number of animals within a short time (1, 19, 22). However, PCR is not very popular in Poland and
Comparative analysis of the PCR and IMF methods
in the diagnosis of Bovine Leukemia Virus infections*
)
BARBARA BOJAROJÆ-NOSOWICZ, EWA KACZMARCZYK
Department of Animal Genetics, Faculty of Animal Bioengineering, University of Warmia and Mazury, M. Oczapowskiego 5, 10-719 Olsztyn
Bojarojæ-Nosowicz B., Kaczmarczyk E. Comparative analysis of the PCR and IMF methods in the diagnosis of Bovine Leukemia Virus infections
Summary
The application of sensitive methods, enabling the detection of early infections and to diagnose the bovine leukemia virus (BLV), which ensures the eradication of this virus from herds. The aim of this study was to compare the PCR test with the IMF method for BLV diagnosis. The study involved 59 Holstein-Friesian cows aged 3-7 years and 53 heifers aged 2-6 months. Statistically significant differences were observed with respect to the effectiveness of the PCR and IMF methods during the first month after calving in cows and in older group heifers. The results of this comparison indicate that the IMF method permits the identification of a greater number of BLV carries than the PCR test. In addition, IMF may be more useful for diagnosing BLV infections than PCR.
Keywords: cows, heifers, BLV, diagnosis, PCR, IMF, methods
*) This work was financially supported by the Ministry of Science and Hi-gher Education, (Grant No. 2 PO6K 036 30) and the University of Warmia and Mazury in Olsztyn.
Medycyna Wet. 2008, 64 (12) 1394
it is mostly used for the diagnosis of EBL under the appeal procedure.
The immunofluorescence (IMF) method allows the identification of the virus antigen directly in the infected cells. It is used for the diagnosis of infections caused by several types of viruses (including the rabies virus, canine distemper virus, classical swine fever CSF virus), but it has not been applied in the diagnosis of EBL to date.
The objective of this study was to compare the sensitivity of PCR and IMF methods in the diagnosis of BLV infections.
Material and methods
The study was conducted on 59 Polish Holstein-Friesian (Black-and-White) cows aged 3 to 7 years and 53 heifers aged 2 to 6 months from two certified brucellosis-free and tubercu-losis-free herds kept in north-eastern Poland. The cows were housed in tie-stalls, and heifers were housed in pens.
Blood was collected for analyses from the mammary or jugular vein, with heparin as an anticoagulant. The cows were examined during the first and third month after calving. The heifers were divided into two groups, one of 31 animals aged 2-3 months, the other of 22 animals aged 5-6 months. BLV was detected by PCR and IMF techniques.
Isolation of genomic DNA. Genomic DNA was isolated from whole peripheral blood using the Master PureTM DNA
Purification Kit for Blood (Epicentre Technologies, USA), following the manufacturers procedure. The quantity and quality of the isolated DNA was determined with a spectro-photometer (GeneQuant Pharmacia USA) and by electro-phoresis in 1.5% agarose gel stained with ethidium bromide. Amplification of the gag gene of BLV. A fragment of BLV proviral genome, 364 bp in length, in the 628-1806 bp region of the gag gene, and a fragment of the kappa-casein gene (CASK), 273 bp in length (indicator of the normal course of PCR), were amplified. The composition of the reaction mixture, thermal profile and primers have been described elsewhere (5). The nucleotide sequences of primers were as follows (Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Poland):
L E U 1 : 5 G T C G A C A A C C T T C C C G A C G G 3 ; LEU2:5GACAGTCTCGTTTCCAATGG3; CASK1:5GA-AATCCCTACCATCAATACC3; CASK2:5CCATCTAC-GCTAGTTTAGATG3.
PCR products, positive control sample, negative control sample, blank sample and molecular weight marker PhiX 174/ Hae III were electrophoresed in 1.5% agarose gel stained with ethidium bromide, with the use of 0.1 M TBE buffer. The positive control and the negative control comprised samples of the DNA of a BLV-positive and a BLV-negative animal, respectively, in which BLV infection was confirmed or ruled out by ELISA, PCR and IMF procedures. The results were analyzed and archived with the use of the Fluor-STM
Multi-Imager imaging system (Bio-Rad, USA). PCR was repeated if the CASK gene product was not obtained or its quality was unsatisfactory.
Isolation of lymphocytes and immunofluorescence method. Lymphocytes were isolated from peripheral blood by Gradisol L density gradient centrifugation (Aqua-Medica, Poland), as indicated elsewhere (13). Indirect immunofluo-rescence assay was performed as described by Kaczmarczyk
et al. (12). Lymphocytes (1 × 106 cells/ml) were incubated
with a monoclonal antibody BLV3 (VMDR Inc. Pullman, USA) bound to the epitope of the viral protein p24. Next the goat mouse IgG (H+L) PE conjugated secondary anti-body was applied. The same procedure was followed in the case of control tests, except for the incubation with a primary antibody BLV3. The smears were analyzed at magnification 1000 × under a fluorescence microscope (Axiolab-Zeiss) equipped with an appropriate filter set. Two hundred cells per smear were recorded. The percentage of BLV-positive and BLV-negative animals was determined.
Statistical analysis. The significance of differences (p £ 0.05, p £ 0.01 and p £ 0.001) between the tested diagnostic methods was estimated by the chi2 test. Calculations were
performed using Statistica 7.1 software. Results and discussion
Cases of BLV infection were confirmed by PCR amplification of a gene fragment, 364 bp in length (lanes 4 and 6) (fig. 1). A PCR product, 273 bp in length (a fragment of the CASK gene), recorded in all animals, indicated the normal course of PCR (lanes 2, 3, 4, 5, 6 and 7) (fig. 1). The core capsid protein (p24) of BLV was observed in lymphocytes and/or on the surface of infected cells. BLV-positive lymphocytes were identified based on the orange light emitted by phycoerythrin (fig. 2).
364 bp 273 bp
1 2 3 4 5 6 7 8
Fig. 1. Results of BLV detection by PCR
Explanations: Lanes from the left: 1 molecular weight marker PhiX 174/Hae III; 2 positive control sample; 4, 6 positive sample (fragment of the gag gen of BLV and fragment of the CASK gene); 3, 5, 7 negative sample (fragment of the CASK gene); 8 blank sample (PCR components without DNA)
Medycyna Wet. 2008, 64 (12) 1395
Both diagnostic methods applied in the study re-vealed a high percentage of affected animals in the screened herds. The PCR technique confirmed BLV infection in 37% and 88% of cows examined in the first and third month of lactation, respectively (fig. 3). The total number of BLV-positive heifers was also high, reaching 35% and 82% in the first and second age group respectively (fig. 4). Among the animals clas-sified as BLV-positive by PCR there were no cases of individuals identified as BLV-negative by IMF. The IMF method indicated a higher percentage of BLV--positive cows and heifers, compared to PCR (fig. 3, 4). The viral protein p24 was detected in the lympho-cytes of 83% and 93% of cows examined during the first and third month of lactation, respectively (fig. 3). An analysis of lymphocytes in young animals showed the expression of p24 in 52% of heifers aged 2-3 months and in 100% of those aged 5-6 months.
A comparison of the results obtained by PCR and IMF revealed considerable differences, both in the group of cows and older heifers (tab. 1). Among cows, the greatest differences between the number of posi-tive test results obtained by the above methods were noted in the first month of lactation (46%; p < 0.001), while the differences observed in the third month of lactation were small and statistically non-significant (5%; p = 0.34). Statistically significant differences between the results obtained by both techniques were also reported in the group
of older heifers (18%; p < 0.05), whereas in the group of heifers aged 2-3 months those differences were found to be statisti-cally insignificant (16%; p = 0.20).
The higher effective-ness of IMF with regard to the identification of BLV carriers was also demon-strated in our earlier study, in which IMF was
compared with ELISA (12). Statistically significant dif-ferences were reported for cows examined during the first and third month of lactation, as well as for heifers aged 5-6 months. The present and previous studies point to the greater consistency of results obtained by PCR and IMF than by ELISA and IMF, particularly with respect to cows during the third month of lacta-tion. This agrees with the findings of other authors who demonstrated higher sensitivity of PCR compared with ELISA in the diagnosis of EBL (14, 21, 32). However, IMF seems to be more sensitive than the molecular PCR test, as confirmed by a significantly higher num-ber of BLV-positive cows diagnosed by IMF in the first month after calving, and by a higher number of BLV-positive heifers in both age groups, although statistically significant differences were observed only in the group of 5- and 6-month-old heifers.
According to many authors, PCR is a very sensitive method, permitting the detection of the proviruss ge-netic material even in 1-10 pg of genomic DNA (1, 2, 24). Some authors share the opinion that this tech-nique enables detection even if the number of proviral DNA copies is small (24), while others claim that too low a number of proviral copies may decrease PCR sensitivity (7, 17). Moreover, the provirus integration into the host genome takes places at a few sites only, and the number of proviral copies remains small (15, 16). s d o h t e M s p u o r g e lt t a C s w o C Hefiers 1stmonth 3rdmonth 1stgroup 2ndgroup r e b m u N % Number % Number % Number % R C P 22 37.3 52 88.1 11 35.5 18 81.8 F M I 49 83.1 55 93.2 16 51.6 22 100.01 s e c n e r e ff i D ***27*** 45.8 13 15.1 15 16.1 1*4* 18.2 Explanation: * statistically significant differences at p < 0.05; *** statistically significant diffe-rences at p < 0.001
Tab. 1. Number and percentage of BLV-positive cows and heifers and differences between the results obtained by both methods
Fig. 3. Results of diagnosing EBL by PCR and IMF in cows
in the first and third month of lactation Fig. 4. Percentage of BLV+ and BLV heifers determined byPCR and IMF 37 83 63 17 88 93 12 7 0 10 20 30 40 50 60 70 80 90 100 cows % BLV+ BLV– BLV+ BLV– 1 monthst 3 monthrd PCR IMF 35 52 65 48 82 100 18 0 0 10 20 30 40 50 60 70 80 90 100 heifers % BLV+ BLV– BLV+ BLV– 1 groupst 2 groupnd PCR IMF
Medycyna Wet. 2008, 64 (12) 1396
The greater effectiveness of IMF in detecting BLV carriers is difficult to explain, taking into account the molecular character of PCR and the generally known high sensitivity and specificity of this technique. It seems that the observed differences in the number of BLV-positive cows diagnosed with the use of IMF and PCR in the first month after calving could result from the occurrence of new infections in the perinatal pe-riod. Disorders of immunological functions, observed pre- and post-calving, increase the risk of new infec-tions and contribute to the spread of pathogenic mi-croorganisms in the body (23, 29). In leukemic herds, BLV infection rates increase at that time, and the virus is transmitted to the animals which were previously found to be clinically healthy. In the initial phase of infection, the number of lymphocytes with proviral DNA is small, and so is the number of DNA-BLV co-pies available for PCR analysis. A higher percentage of BLV carriers detected among heifers by IMF could also be due to new infections identified in growing animals. The primary route of virus transmission in the herd is direct contact between animals, especially those housed in groups. A common source of infec-tion is also the colostrum and milk of affected cows (10, 20), which provide antibodies against BLV, but also contain BLV-infected lymphocytes. Such lympho-cytes may be responsible for the perpetuation of infec-tion, particularly in young calves whose humoral and cellular immune responses are still deficient.
The IMF method applied in this study permits the direct detection of the virus antigen in different types of cells of an affected animal, regardless of the phase of infection, the age of the animal or the stage of pregnancy and lactation. The results obtained with the use of IMF point to the possibility of identifying BLV carriers also in cases when the number of DNA-BLV copies is too small for PCR analysis. In addition, IMF is simple, easy to perform and enables the examina-tion of a large number of animals within a short time. It may be concluded that the IMF method permits the identification of a greater number of BLV carries than the PCR test. In addition, IMF may be more useful for diagnosing BLV infections than PCR.
References
1.Ballagi-Pordány A., Klintevall K., Merza M., Klingeborn B., Belák S.: Direct detection of bovine leukemia virus infection: practical applicability of a double polymerase chain reaction. Zntbl. Vet. Med. B 1992, 39, 69-77.
2.Brandon R. B., Naif H., Daniel R. C., Lavin M. F.: Early detection of bovine leukosis virus DNA in infected sheep using the polymerase chain reaction. Res. Vet. Sci. 1991, 50, 89-94.
3.Buehring G., Kramme P., Schultz R.: Evidence for bovine leukemia virus in mammary epithelial cells of infected cows. Lab. Invest. 1994, 71, 259-265. 4.Burny A., Bruck C., Cleuter Y., Couez D., Deschamps J., Gregoire D.,
Ghysdael J., Kettmann R., Mammerickx M., Marbaix G.: Bovine leukaemia virus and enzootic bovine leukosis. J. Vet. Res. 1985, 52, 133-144.
5.Czarnik U., Kamiñski S., Ru³ka J., Walawski K.: Modified procedure for detection of proviral DNA of bovine leukemia virus. Bull. Vet. Inst. Pu³awy 2000, 44, 143-146.
6.Da Y., Shanks R. D., Steward J. A., Lewin H. A.: Milk and fat yield decline in bovine leukemia virus infected Holstein cattle with persistent lymphocytosis. Proc. Natl. Acad. Sci. USA 1993, 90, 6538-6541.
7.Eaves F. W., Molloy J. B., Dimmock C. K., Eaves L. E.: A field evaluation of the polymerase chain reaction procedure for the detection of bovine leukaemia virus proviral DNA in cattle. Vet. Microbiol. 1994, 39, 313-321.
8.Ferrer J. F., Piper C. E.: An evaluation of the role of milk in the natural trans-mission of BLV. Ann. Rech. Vet. 1978, 9, 803-807.
9.Gatei M., McLennan M., Levin M., Daniel R.: Experimental infection of sheep with bovine leukemia virus infectivity of blood, nasal and saliva secretions. J. Vet. Med. B 1989, 36, 652-660.
10.Grundboeck-Juko J., Kumak J.: Wystêpowanie przeciwcia³ dla wirusa enzootycznej bia³aczki byd³a w siarze krów bia³aczkowych. Medycyna Wet. 1989, 45, 330-332.
11.Heeney J., Valli P., Jacobs R., Valli V.: Evidence for bovine leukemia virus in-fection of peripheral blood monocytes and limited antigen expression in bovine lymphoid tissue. Lab. Invest. 1992, 66, 608-617.
12.Kaczmarczyk E., Bojarojæ-Nosowicz B., Cybulska O.: Comparative analysis of an enzymelinked immunosorbent assay and a fluorescent antibody test for the diagnosis of bovine leukaemia virus infection in cattle. Bull. Vet. Inst. Pulawy 2008, 52, 19-22.
13.Kaczmarczyk E., Fiedorowicz A., Bojarojæ-Nosowicz B., wiêcicka-Grabow-ska M., Jakubowski K.: Lymphocyte proliferation efficiency in the first monts of life of heifer calves naturally infected with bovine leukaemia virus. Bull. Vet. Inst. Pulawy 2005, 49, 9-14.
14.Kaczmarczyk E., Pawelec M., Bojarojæ-Nosowicz B.: Porównanie testu ELISA i PCR w diagnozowaniu zaka¿eñ wirusem enzootycznej bia³aczki byd³a. Medy-cyna Wet. 2004, 60, 822-825.
15.Kettman R., Cleuter Y., Mammericx M.: Genomic integration of bovine leuke-mia virus: comparison of persistent lymphocytosis with lymph node tumor form of enzootic bovine leukosis. Proc. Natl. Acad Sci. USA 1980, 77, 2577-2581. 16.Kettman R., Deschamps J., Cleuter Y., Couez D., Burny A., Marbaix G.:
Leuke-mogenesis by bovine leukemia virus: proviral DNA integration and lack of RNA expression of viral long terminal repeat and 3 proximate cellular sequences. Proc. Natl. Acad. Sci. USA 1982, 79, 2465-2469.
17.Koyama H., Hohdatsu T., Nagai T., Tsubaki S.: Determination of lymphocyte count necessary for isolating bovine leukaemia virus (BLV) from BLV-infected cattle and correlation between lymphocyte count and antibody titre. Zntbl. Vet. Med. B. 1988, 35, 648-653.
18.Kumak J.: Wykorzystanie biotechnologii w diagnostyce i zwalczaniu zaka¿eñ wirusem bia³aczki byd³a. Biotechnologia 2003, 60, 74-83.
19.Kumak J., Grundboeck J., Kozaczyñska B.: Wykrywanie prowirusowego DNA wirusa bia³aczki byd³a metod¹ polymerase chain reaction (PCR). Medycyna Wet. 1993, 49, 312-315.
20.Lassauzet M. L., Johnson W. O., Thurmond M. C., Stevens F.: Protection of colostral antibodies agains bovine leukemia virus infection in calves on a Cali-fornia Dairy. Can. J. Vet. Res. 1989, 53, 424-430.
21.Martin D., Arjona A., Soto I., Barquero N., Viana M., Gomez-Lucia E.: Compa-rative study of PCR as a direct assay and ELISA and AGID as indirect assays for the detection of bovine leukaemia virus. J. Vet. Med. B 2001, 48, 97-106. 22.Murtaugh M. P., Lin G. F., Haggard D. L., Weber A. F., Meiske J. C.: Detection
of bovine leukemia virus in cattle by the polymerase chain reaction. J. Virol. Methods. 1991, 33, 73-85.
23.Nagahata H., Ogawa A., Sanada Y., Noda H., Yamamota S.: Peripartum changes in antibody producing capability of lymphocytes from dairy cows. Vet. Q. 1992, 14, 39-40.
24.Naif H. M., Brandon R. B., Daniel R. C., Lavin M. F.: Bovine leukaemia pro-viral DNA detection in cattle using the polymerase chain reaction. Vet. Micro-biol. 1990, 25, 117-129.
25.Pollari F. L., Wangsuphachart V. L., Digiacomo R. F., Evermann J. F.: Effects of bovine leukemia virus infection on production and reproduction in dairy cattle. Can J. Vet. Res. 1992, 56, 289-295.
26.Rhodes J. K., Pelzer K. D., Johnson Y.: Economic implications of bovine leu-kemia virus infection in mid-Atlantic dairy herds. J. Am. Vet. Med. Assoc. 2003, 223, 346-352.
27.Rovnak J., Casey J., Boyd A., Gonda M., Cockerell G.: Isolation of bovine leu-kemia virus infected endothelial cell from cattle with persistent lymphocytosis. Lab. Invest. 1991, 65, 192-202.
28.Schwartz I., Bensaid A., Polack B., Perrin B., Berthelemy M., Levy D.: In vivo leukocyte tropism of bovine leukemia virus in sheep and cattle. J. Virol. 1994, 68, 4589-4596.
29.Shafer-Weaver K. A., Pighetti G. M., Sordillo L. M.: Diminished mammary gland lymphocyte functions parallel shifts in trafficking patterns during the post-partum period. Proc. Soc. Exp. Biol. Med. 1996, 212, 271-279.
30.Stott M. L., Thurmond M. C., Dunn S. J., Osburn B. I., Stott L.: Integrated bovi-ne leukosis proviral DNA in T helper and T cytotoxic/suppressor lymphocytes. J. Gen. Virol. 1991, 72, 307-315.
31.Thurmond M. C., Holmberg C. H., Picanso J. P.: Antibodies to bovine leukemia virus and presence of malignant lymphoma in slaughtered California dairy cattle. J. Natl. Cancer Inst. 1985, 74, 711-714.
32.Trono K., Perez-Filgueira D., Duffy S., Borca M., Carrillo C.: Seroprevalence of bovine leukemia virus in dairy cattle in Argentina: comparison of sensitivity and specificity of different detection methods. Vet. Microbiol. 2001, 83, 235-248. 33.Zwalczanie enzootycznej bia³aczki byd³a na terenie województwa
warmiñsko--mazurskiego. Materia³y z Wojew. Insp. Wet. w Olsztynie 2007.
Authors address: dr Barbara Bojarojæ-Nosowicz, ul. M. Oczapowskie-go 5, 10-719 Olsztyn; e-mail: b.bojarojc@uwm.edu.pl
