Improving production of β-lactam antibiotics by Penicillium chrysogenum - Metabolic engineering based on transcriptome analysis -
Tânia Veiga 2012
Improving production of β-lactam antibiotics by
Penicillium chrysogenum
- Metabolic engineering based on transcriptome analysis -
Proefschrift
ter verkrijging van de graad van doctor aan de Technische Universiteit Delft,
op gezag van de Rector Magnificus, prof. ir. K.C.A.M. Luyben, voorzitter van het College voor Promoties,
in het openbaar te verdedigen op woensdag 30 mei om 15:00 uur
door
Tânia VEIGA DOS INOCENTES
Mestre em Engenharia Biológica, Instituto Superior Técnico, Portugal, geboren te Mina, Portugal
Prof. dr. J. T. Pronk Copromotor: Dr. J-M. Daran
Samenstelling promotiecommissie:
Rector Magnificus voorzitter
Prof. dr. J. T. Pronk Technische Universiteit Delft, promotor Dr. J-M. Daran Technische Universiteit Delft, copromotor Prof. Dr. J.H. de Winde Technische Universiteit Delft
Prof. Dr. Han Wösten Universiteit Utrecht Prof. Gilles van Wezel Universiteit Leiden
Prof. Merja Penttilä VTT Technical Research Centre of Finland Dr. Andreas Gombert Universiteit van São Paulo, Brazil
Prof. dr. ir. J. J. Heijnen Technische Universiteit Delft, reservelid
The research described in this thesis was performed at the Industrial Microbiology Section, Department of Biotechnology, Faculty of Applied Sciences, Delft University of Technology, The Netherlands. The Industrial Microbiology Section is part of the Kluyver Center for Genomics of Industrial Fermentation, which is supported by the Netherlands Genomics Initiative.
Financial support was provided by the program of the Netherlands Organization for Scientific Research (NWO) via the IBOS (Integration of Biosynthesis and Organic Synthesis) Programme of Advanced Chemical Technologies for Sustainability (ACTS) and by DSM.
E-mail: Tania.Veiga@gmail.com ISBN: 978-90-8570-852-0 Thesis printed by CPI
Para o meu avô, o meu anjo da guarda
1. General introduction 1 2. Impact of Velvet complex on transcriptome and penicillin G production in
glucose-limited chemostat cultures of a β-lactam high-producing Penicillium
chrysogenum strain 27
3. Resolving phenylalanine metabolism sheds light on natural synthesis of
penicillin G in Penicillium chrysogenum 67
4. Metabolic engineering of β-oxidation in Penicillium chrysogenum for improved semi-synthetic cephalosporin biosynthesis
109
5. Functional characterization of the oxaloacetase encoding gene and elimination of oxalate formation in the -lactam producer Penicillium chrysogenum
141
6. Conclusions and future perspectives 163
7 Summary 167
Samenvatting List of Publications Curriculum Vitae Acknowledgments
General introduction
Chapter 1
3
The modern antibiotics era
The use of natural substances with antimicrobial activity in medicine dates back to, at least, 2000 B.C. Plants, plant oil extracts and moulds have been employed by many ancient civilizations (including Egyptian, Chinese, Greek and Roman) to treat infectious diseases. While there was an empirical basis for the use of some of these compounds, other treatments were based on a belief that every substance in nature has beneficial properties, even though the healing mechanisms were not understood 1.
The term antibiotic (from the Greek anti – against and bios - life) was coined by Selman Waksman in 1941 to describe chemical compounds, synthesized by microorganisms, that are able to impair the growth of other microorganisms 2. The first antibiotic was discovered in 1929 by Sir Alexander Fleming 3. At the time, Fleming’s research focused on the properties of the bacterium Staphylococcus aureus and the discovery of a bacteria-killing compound was accidental. While sorting Petri plates previously inoculated with S. aureus, Fleming noticed that one plate had been contaminated by a fungus and that no bacteria grew around the fungal colony. In follow-up research with a pure culture of the fungus, Fleming showed that the filtered broth had inhibitory, bactericidal and bacteriolytic properties. The fungus was originally classified by Fleming as Penicillium rubrum, but it was later identified as Penicillium notatum and afterwards renamed Penicillium chrysogenum. After some months of calling the broth “mould juice”, Fleming named the active substance penicillin. Fleming was immediately aware of the potential of penicillin as a surface antiseptic. However, the difficulty in cultivating Penicillium and the low concentrations of the active compound in culture broth led him to believe that penicillin would not be important in treating wound infections and eventually he did not follow up this work.
A decade after Fleming’s discovery, in 1940, Howard Florey and Ernst Chain, together with their research team, made significant progress in extracting active penicillin and demonstrating its bactericidal activity in vivo 4. They also extensively studied the impact of cultivation conditions on the synthesis of penicillin. Optimization of growth conditions enabled them to produce enough material for a first clinical trial 5. Despite this progress, the amount of penicillin produced by Fleming’s Penicillium strain was insufficient to treat several people. In fact, the first patient treated with injections of penicillin showed a remarkable recovery, but subsequently died when there was not enough penicillin to complete the treatment 6.
The interest in mass production of penicillin increased upon the outbreak of World War II. Governments and pharmaceutical companies in the allied countries collaborated in improving large-scale penicillin production. After an intensive search, a high-producing Penicillium strain was isolated, in 1943, from a moldy cantaloupe. This strain, P. chrysogenum NRRL 1951, was isolated by Mary Hunt (affectionately called “Moldy Mary” by her colleagues) at the Northern Regional Research Laboratories (NRRL) in Illinois (USA). This strain not only produced higher amounts of penicillin than previously characterized strains but, importantly, also allowed submerged cultivation 1, 7. The ensuing development of deep-tank cultivation protocols for the NRRL 1951 strain
4 enabled an intensive scale-up programme. Amazingly, sufficient quantities of penicillin
were available to treat allied soldiers wounded on D-Day (June 6, 1944) 7 (Figure 1).
Penicillin research was also developed in the Netherlands. Research began in secret while the country was still under German occupation in 1944. The Dutch company Nederlandsche Gist- en Spiritusfabriek (NG&SF, later called Gist-Brocades and now DSM) requested Penicillium strains from the Centraalbureau for Schimmelcultures and initiated research under the code name Bacinol (Figure 2).
This research was so successful that, at the end of WWII, commercial production could immediately start at the Delft site and ‘home-made’ penicillin could be introduced on the Dutch market in 1946 8-10. Fleming’s fortuitous discovery in 1928 marks the beginning of the development of modern antibiotics, with penicillins still being the most widely used antibiotics to date, followed by related β-lactam antibiotics such as cephalosporins.
Figure 1 –Flyer advertising the impact of the discovery of penicillin and its use during World War II. Source: Research and Development Division, Schenley Laboratories, Inc., Lawrenceburg, Indiana.
5
β-Lactam antibiotics
Since Fleming’s discovery, the definition of the term ‘antibiotic’ has been modified. Nowadays, the term antibiotic is no longer restricted to compounds naturally produced by microorganisms but also encompasses synthetic and semisynthetic compounds of similar antimicrobial activity. Although the natural role of microbially produced antibiotics is not fully understood, the commonly accepted function of these metabolites is to provide a competitive advantage and protection against other organisms in the natural niche 11. For some antibiotics, alternative physiological functions have been proposed, including compound detoxification by peptidation, in which the toxic compound is attached to a synthesized peptide (e.g. penicillins are carboxylic acids attached to a peptide), signal molecules and transcriptional regulators 11, 12. However, since the emphasis in research has been on the therapeutic value of antibiotics, the optimization of productivity, efficacy and product yield are the main focus of scientific investigation.
The lack of action of penicillin against organisms other than Gram-positive bacteria stimulated research to find antibiotics with novel activities. Currently, over 70,000 data records about antibiotics and their therapeutic activities have been reported in the scientific literature 13 (Table 1). In 2009, the antibiotics market exceeded $37 billion, and a further growth to $50 billion has been forecast for 2015 14.
Figure 2- Picture of the Gist- en Spiritusfabriek factory in Delft (The Netherlands) where penicillin was produced under the code name Bacinol.
6 Table 1 – Classes of antibiotics and their mechanism of action.
Cellular target in pathogen Antibiotic class Examples Cell wall biosynthesis β-lactams
Glycopeptides Cephalexin Penicillin G/V Vancomycin Protein synthesis Aminoglycosides Macrolides Lincosamides Oxazolidinones Streptogramins Tetracyclines Gentamicin Erythromycin Clindamycin Linezolid Pristinamycin Tetracycline DNA replication Quinolones
Fluoroquinolones Ciprofloxacin Norflox Folate synthesis Sulphonamides Sulfamethoxazole
Economically, β-lactams form the most important antibiotic class, accounting for a market share of $7.7 billion in 2006 (according to the IMS Health 15). Characteristic of this group is the presence of a β-lactam ring 16, which needs to be activated by a radical (commonly another heteroatomic ring) in order to attain biological activity. The addition of a side chain to the double ring structure defines different sub-classes of β-lactam antibiotics (Table 2). β-lactams are naturally produced by a wide range of microorganisms, ranging from filamentous fungi to Gram-positive and Gram-negative bacteria (Table 2).
The success in the administration of β-lactam antibiotics is linked to their high antibacterial activity, low toxicity and low price. This, unfortunately, has led to a rather careless prescription policy and consequently to the emergence of resistant bacterial strains 17, 18, providing a strong incentive for development of novel antibiotics 19.
7
Table 2 – Chemical structures of different β-lactam antibiotics sub-classes 20, 21.
β-lactam antibiotic Chemical structure Producing microrganisms
Penicillins Penicillium chrysogenum Penicillium notatum Aspergillus nidulans Cephalosporins Acremonium chrysogenum Streptomyces clavuligerus Flavobacterium sp. Carbapenems Streptomyces clavuligerus Streptomyces olivaceus Erwinia carotovora Monolactams Nocardi uniformis Agrobacterium radiobacter Pseudomonas acidophila
Penicillium chrysogenum, an antibiotic producer Penicillium is a genus belonging to the Ascomycetes family of fungi. The name Penicillium derives from the shape of the conidiophores, which resemble paintbrushes (penicillus means paintbrush in Latin) (Figure 3). The filamentous Penicillium species are widespread in nature, and are involved in societally relevant activities such as food spoilage, production of flavour-related compounds and, of course, antibiotics synthesis 22, 23.
P. chrysogenum is among the most intensively studied species of the Penicillium genus. Its life cycle starts with the formation of spores, which are commonly carried to new
colonization sites by airborne migration. Upon encountering an environment that allows growth, the spores germinate. Three different phases can be distinguished in the germination process: activation, isotropic growth and polarized growth 24. Activation of germination is stimulated by the presence of external effectors (e.g. temperature, light, Figure 3 – Microscope image of Penicillium chrysogenum mycelia. Source: Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands.
8 moisture or rich medium). The subsequent phase of isotropic growth is characterized by
an increase in spore size due to swelling from water uptake. Simultaneously, wall growth is observed and the cell exits its dormant phase to become metabolically active 25-27. In the final germination phase, spherical growth is arrested and wall growth is polarized in a single direction. At this stage, the spore wall growth resembles the budding phase in yeast and the forming germ tube develops into the typical filamentous fungal hypha. The germination process in P. chrysogenum occurs over a period of 10 to 40 hours 28.
Fully grown P. chrysogenum mycelia consist of a vast network of complex hyphal structures. Each cell belonging to a hypha is in direct contact with its neighboring cells, since the septa between adjacent living cells allow for transport of cytosolic constituents. Different areas in the hypha can be identified based on their specific functions. The apical compartment, which is localized at the growing ends of hyphae, is responsible for tip growth and penicillin production. The cells in the subapical compartment, just behind the septa, have a similar composition as the apical cells and are most likely involved in supplying cell material to the apical compartment as the hypha expands. Cells that are further from the hyphal tip are not directly linked to hyphal extension, but are thought to provide osmotic pressure to transport protoplasm towards the tip 29.
The tremendous economic and societal importance of P. chrysogenum as an antibiotic producer in the pharmaceutical industry has stimulated intensive research into the biochemistry and molecular biology of β-lactam antibiotics biosynthesis by this fungus. The biosynthetic pathways for synthesis of β-lactams in P. chrysogenum have been elucidated over the last decades. Penicillins are a natural product of wild strains of Penicillium chrysogenum, while cephalosporins and cephamycins precursors can only be synthesized by modified strains of Penicillium chrysogenum. These three antibiotics have the first biosynthetic steps in common (Figure 3). Biosynthesis starts with the condensation of the amino acid precursors L-cysteine, L-valine and L-α-aminoadipic acid, forming the tripeptide δ-(L-α-aminoadipyl)-L-cysteinyl-D-valine (ACV). This step is catalyzed by the non-ribosomal peptide synthase (NRPS) δ-(L-α-aminoadipyl)-L-cysteinyl-D-valine synthase (ACVS), encoded by pcbAB 30, 31. In the second step, the isopenicillin (IPN) synthase, encoded by pcbC, catalyzes an oxidative ring closure, leading to the formation of the characteristic β-lactam ring structure 32. Isopenicillin N already presents some antibacterial activity and is the pathway branching point for synthesis of cephalosporins and penicillins. Penicillins are synthesized by exchange of the α-aminoadipic acid moiety for a Coenzyme A-activated side chain, via the enzyme acyl-coA:isopenicillin N transferase, encoded by penDE (Figure 3). The side chain percursor defines the type of penicillin produced. For example, the use of phenylacetyl-Coenzyme A or phenoxyacetyl-phenylacetyl-Coenzyme A as side-chain precursors leads to the production of penicillin G and penicillin V, respectively 30, 31, 33.
Cephalosporin synthesis is initiated by epimerization of isopenicillin N to penicillin N. This step is catalyzed by an IPN epimerase encoded by the cefD gene. The 5-membered thiazolidine ring is subsequently expanded to the 6 5-membered thiazolidine ring from deacetoxycephalosporin C, by the deacetoxycephalosporin C synthetase (DAOCS, encoded by cefF). Deacetoxycephalosporin C is then hydroxylated to
9
deacetylcephalosporin C, via deacetylcephalosporin C synthetase (DACS, encoded by cefF). At this point, cephalosporin and cephamycin biosynthesis diverge. The last step of cephalosporin synthesis is the acetylation of deacetylcephalosporin C into cephalosporin C, by the enzyme deacetylcephalosporin C acetyltransferase, encoded by cefG (Figure 4). Cephamycins are produced by having the C-3’ hydroxyl group carbamoylated by deacetylcephalosporin C O-carbamoyltransferase, encoded by the gene cmcH. As final step, a C-7 methoxy group is added by O-carbamoyldeacetylcephlosporin-C-7-methoxyl transferase (encoded by cmcH) to form cephamycin-C (Figure 3). P. chrysogenum, which does not naturally produce cephalosporins, has been engineered to produce adipoyl-7-amino-3-carbamoyloxymethyl-3-cephem-4-carboxylix acid (adACCA), a synthon for semi-synthetic cephalosporins 34. This was accomplished by expression of an Acremonium chrysogenum expandase and hydroxylase gene (cefEF) and a Streptomyces clavuligerus carbamoyltransferase (cefF) gene (Figure 4).
10
Figure 4 – Biosynthetic routes for the production of the β-lactams penicillin, cephalosporin and cephamycin. The route towards adACCA (on the left) was introduced into P. chrysogenum by metabolic engineering. Genes are indicated in italic. Figure adapted from Harris et al. (2009) 34.
11
The availability of an assembled and annotated genome sequence for Penicillium chrysogenum Wisconsin 54-1255 35 allowed the use of genomics tools for a thorough functional characterization of this important industrial microorganism 34, 36-38. The P. chrysogenum genome contains 12,960 open reading frames (32.19 Mb). The nomenclature of these open reading frames is given as follows: Pc for Penicillium chrysogenum, a two digit supercontig number followed by g (standing for gene) and a five digit number representing the ORF position on the contig (e.g. Pc21g21390, pcbAB).
Due to its relevance, penicillin genes have been extensively characterized. In P. chrysogenum, the genes responsible for penicillin synthesis (pcbAB, pcbC and penDE) are clustered and located on chromosome I (Figure 5) 39, 40. This clustering of genes is not unique for β-lactam biosynthesis in P. chrysogenum but common for fungal genes involved in the production of secondary metabolites 20, 41.
Figure 5 – Schematic representation (not to scale) of the penicillin genes clustered on chromosome I in P. chrysogenum.
The road towards modern industrial penicillin production
The Penicillium strain isolated by Fleming in 1929 3 produced low titers of penicillin. Several attempts were made to find strains with a higher penicillin production capacity (reviewed by Rodriguez-Saiz et al. (2005) 42). The isolated strain NRRL 1951 was used to start several classical strain improvement programs to improve industrially relevant characteristics (Figure 6). This strain improvement did not only involved selection for higher penicillin titers but also for better fermentation capabilities, including improved morphology, reduced cultivation time, elimination of side chain precursor catabolism and use of cheap substrates. Classical strain improvement programs are based on random mutagenesis (radiation, chemicals, etc) followed by screening and selection of the best performing strain under relevant conditions. Although extremely powerful and robust, this method is laborious and time consuming. Despite the advent of modern techniques for metabolic engineering, classical strain improvement continues to be applied in industry due to its high success rate. One of the programs that contributed to the spectacular improvement of P. chrysogenum strains with desirable traits for industrial penicillin production was the Panlabs strain improvement program 43. Another improvement program was headed by the University of Wisconsin 44, resulting in the isolation of the strain Wisconsin 54-1255, nowadays a widely used laboratory strain.
12
Figure 6 – Classical strain improvement programs derived from Penicillium chrysogenum strain NRRL 1951. The parental strain P. chrysogenum NRRL 1951 and strain Wisconsin 54-1255 are marked in grey. Adapted from Newbert,R.W et al. (1997) 40.
13
One of the obtained strains from a classical strain improvement program is the strain P. chrysogenum DS17690, with a penicillin productivity higher than the parental strain Wisconsin 54-1255 35. When analyzing P. chrysogenum DS17690, it was found an increase in the copy number of the penicillin biosynthesis genes from 1 copy in P. chrysogenum Wisconsin 54-1255 and NRRL1951 to 7-8 in this strain 45, 46. These amplifications occured as tandem repeats of the gene cluster that harbors the P. chrysogenum penicillin biosynthesis genes 39, 40. The amplified region has a size of 56.8 kb and contains 16 putative open reading frames of which 8 are expressed under penicillin production conditions 47. The constitutive higher transcript level of the penicillin biosynthetic genes suggests that loss of regulation has occurred during the improvement program 46, 48.
Another reason for the observed higher titers of penicillin G in later strains of the lineage is the elimination of the degradation of phenylacetic acid (PAA), which is added to cultures as a side-chain precursor. PAA catabolism occurs via the homogentisate pathway, with integration into the central carbon metabolism via acetate and fumarate (Figure 7). Strains from the improvement program at the University of Wisconsin, e.g. Wisconsin 54-1255, have a point mutation on the phenylacetate hydroxylase gene that leads to a strongly decreased enzyme activity, thereby preventing growth on PAA. Indeed, increased penicillin titers, higher PAA conversion efficiency and reduced growth were observed for this strain relative to ancestor strains that still have an active phenylacetate hydroxylase gene (pahA) 49. Similar results were obtained in Aspergillus nidulans, in which phenylacetate hydroxylase mutants were not able to grow on PAA as sole carbon source 50. Nevertheless, trace amounts of 2-hydroxyphenylacetate can still be detected in culture broth of modern P. chrysogenum strains 49. This observation suggests that complete inactivation of the pahA gene by targeted metabolic engineering may still lead to further improvement of side-chain-precursor utilization. Figure 7 – Phenylacetic acid
metabolism via the homogentisate pathway.
14 Side-chain precursors
The cultivation of P. chrysogenum in complex media results in the synthesis of a wide range of ‘natural’ antibiotics 51. Studies performed by Moyer and Coghill 52, 53 showed that growth in corn steep liquor results in higher penicillin titers and a predominant production of penicillin G. This discovery instigated the identification of precursors that stimulate the production of specific β-lactams, while contributing simultaneously to the development of synthetic production media 54, 55.
The incorporation of a side-chain precursor in the β-lactam backbone is fundamental for the synthesis of functional penicillins and semi-synthetic cephalosporins, whose efficiency is related to bacterial toxicity as well as resistance to oxidation (reviewed by Brakhage et al. (1998) 21). Prior to its addition to the β-lactam structure, the side-chain precursor needs to be activated by a CoA-ligase. These enzymes belong to the adenylate protein family, whose members activate acyl or aryl acids into the corresponding CoA thioesters. P. chrysogenum harbors a large number of CoA-ligase-encoding genes 56. Enzymes from this family differ with respect to their (often promiscuous) substrate specificity and cellular localization 57, and together accept a wide range of substrates. The identification of the ligase involved in penicillin G production has been of high interest, since this step has been suggested to be rate limiting 58. Indeed, functional expression of a phenylacetate-CoA ligase (PCL) from Pseudomonas putida in P. chrysogenum resulted in higher penicillin yields 58.
In its natural habitat, Penicillium chrysogenum produces penicillin G, F and K, which contain the amphipathic weak acids phenylacetic acid, trans-3-hexenoic acid and caprylic acid as side chains, respectively. P. chrysogenum strains have been shown to produce a mixture of these penicillins when no additional side chain precursor is supplied to the medium 59. When grown in defined media in the presence of medium or long chain fatty acids, higher levels of penicillin K and F were observed 60, 61.
Activation of these fatty acids most probably occurs via a CoA-ligase with a broad substrate range. Consistent with this notion, the hitherto identified phenylacetate-CoA ligases are able to activate these natural penicillin side chain precursors 56. A modelling approach combined with substrate-specificity assays suggested that phenylacetate-CoA ligases are not optimized for PAA activation, but instead for medium-chain-length fatty acids 62. Further support for this idea is provided by the observation that high amounts of penicillin K, which contains an n-heptyl group as side chain, are produced in even in media culture supplemented with other side-chain precursors 63. The rapid inactivation of this group of ‘natural’ penicillins in animals and humans stimulated the exploration of other penicillins.
The discovery of phenylacetic acid as a constituent of corn steep liquor 52, 53 and degradation product of penicillin G 64 combined with labeling studies 65 allowed the identification of this side chain precursor. For efficient production of penicillin G, addition of PAA to P. chrysogenum cultures is performed in a controlled fashion, assuring a concentration that does not limit penicillin G production and avoids PAA toxicity 66. The mechanism for PAA uptake by P. chrysogenum is yet not fully
15
understood. Being a weak acid, PAA can, in principle, freely enter the cell via passive diffusion, depending on the transmembrane pH gradient 67. On the other hand, Fernandez-Canon and colleagues have shown that active transport is involved in PAA uptake 68. Such contradictory conclusions may be related to the different conditions applied in both studies, in particular the P. chrysogenum strains and PAA concentration used. When present at high concentrations (60 - 3000 mM), PAA enters the cell via passive diffusion. Low PAA concentrations (1.4 – 100 mM) have a different effect in low and high penicillin producing strains. In low-producing strains, PAA accumulation is 10 fold lower when compared to high-producing strains which suggests the presence of a transporter in the latter strains 69. An alternative explanation for these differences in PAA accumulation might be related to its activation by the CoA-ligase. In the industrial production of penicillin G, PAA concentration can be kept at such levels that passive diffusion is the main uptake mechanism in use.
Multiple CoA-ligases seem to be able to activate PAA, but one phenylacetyl-coA ligase (PCL) seems to have the main role 70. In 1997, Gledhil and colleagues 71 purified a phenylacetyl-coA ligase (PCL) from P. chrysogenum and sequenced the enzyme’s N-terminus. Four years later, the complete PAA-CoA-ligase-encoding gene seqence (phl) was made available 72. The gene phl is present as a single copy in the genome, outside the 56.8 kb penicillin cluster amplified region. This indicates a distinct evolutionary origin for the other penicillin biosynthesis genes. Deletion of phl resulted in reduced penicillin production, thereby confirming the involvement of this enzyme in PAA activation. In agreement with these results, phl overexpression resulted in higher penicillin G yields 70. Purification of P. chrysogenum PCL enzymes has been described and their enzymatic properties have been assessed 71, 73. Kogekar and co-workers reported a Km value for PAA of 2.9 µM 74, while Koetsier and colleagues described a higher value of 6.1 µM 62. The deletion of phl in P. chrysogenum did not completely eliminate penicillin G formation. This indicates the presence of more than one PCL enzyme, explaining the different results obtained by Kogekar and Koetsier. PCL contains a PTS1 sequence (SKI) for peroxisome targeting 62. Recently, a peroxisomal CoA ligase from P. chrysogenum was reported to have PAA-CoA activity, thereby suggesting the involvement of this enzyme in penicillin G biosynthesis 75. PCL invariably shows a higher activity with aliphatic fatty acids than with PAA 62. The broad substrate range of the PCLs described so far, combined with the low PAA activity measured make these P. chrysogenum enzymes rather different from the PCLs identified in bacteria 76, 77.
In addition to PAA incorporation in penicillin G, this acid can also be oxidized via the homogentisate pathway (Figure 6), with final formation of acetoacetate and fumarate 78, 79. As mentioned above, efficient side chain incorporation was one of the first traits to be selected for in the classical strain improvement programs. The penicillin G high-producing strain P. chrysogenum Wisconsin 49-133 contains a single copy of the pahA gene. This gene encodes phenylacetate hydroxylase, which hydroxylates PAA to 2-hydroxyphenylacetate, with a C598T point mutation that resulted in a lower enzymatic activity and therefore a higher PAA yield.
16 A biosynthetic route for 7-ADCA production (Figure 3) was introduced in
Penicillium chrysogenum by Crawford and colleagues in 1995 80. In the presence of the side-chain precursor adipic acid (ADA) P. chrysogenum can naturally convert isopenicillin N (IPN) to ad-6-APA via the isopenicillin N acyltransferase penDE, which is also involved in the incorporation of PAA in penicillin G 81. The introduction of the gene cefE from Streptomyces clavuligerus, which encodes a deacetoxycephalosporin C synthetase (commonly known as expandase), allowed the expansion of the 6-APA five- membered ring structure to the six-membered ring characteristic for cephalosporins, thereby yielding adipoyl-7-ADCA 80, 82. Subsequently, the adipate side chain is cleavage by enzymatic catalysis, leading to the formation of 7-ADCA 83.
Besides being used as a side chain precursor, adipic acid is also used as carbon source in primary metabolism 82. ADA degradation is industrially undesirable, as decreases product yield and increases production cost. Labelling studies and chemostat- based transcriptome analysis in P. chrysogenum indicated that ADA catabolism occurs via β-oxidation 84, 85. An investigation into the acyl-CoA dehydrogenases and oxidases involved in P. chrysogenum β-oxidation is described in this thesis (chapter 4).
Non-ribosomal peptides
The increased incidence of antibiotic resistance in pathogenic bacteria, such as the frequent occurrence of methicillin resistant Staphylococcus aureus (MRSA), shows the need of identifying novel compounds with antibacterial properties. A class of metabolites that is actively explored for this purpose is the non-ribosomal peptides (NRP). NRPs described in the literature have a wide range of biological activities, including toxins, siderophores, cytostatics, immunosuppressants and antibiotics, including β-lactams 86-89.
These compounds are synthesized via reactions that are independent of the protein synthesis machine, using large multifunctional enzymes called non-ribosomal peptide synthetases (NRPS). The use of these systems overcomes certain limitations of the ribosomal peptide biosynthesis machinery, such as the exclusive utilization of proteinogenic amino acids 90. The modular organization of NRPS has been unraveled through gene sequencing and structure-function studies. Each module is composed of different domains, comprising all necessary catalytic activities for the NRP synthesis (Figure 8).
17
Figure 8 - Schematic representation of the modular organization of a non-ribosomal peptide synthetase. The initiation module (containing the adenylation and thiolation domains) is the first module of the NRPS, being also known as minimal module. The presence of the condensation domain characterizes the elongation module. The last module contains a termination domain, responsible for releasing the mature NRP. Extra modification domains can also be present in the NRPS structure.
The order of the modules and the incorporated domains determine the amino acid sequence and modifications in the NRP. The adenylation (A) domain recognizes the cognate amino acid substrate and activates it to an aminoacyl adenylate, with the consumption of ATP. Although this activation occurs in a similar way as in the aminoacyl-tRNA synthetases that are active in the ribosomal system, no gene sequence homology is shared between the enzymes active in the two processes. Regarding specificity of the amino acid recognition, the A domain was found to be less stringent than aminoacyl-tRNA synthetases 91, 92. Once activated, the aminoacyl adenylate is covalently bound, as a carboxy thioester, to the peptidyl carrier protein (PCP) or thiolation (T) domain. The covalent bond between the aminoacyl adenylate and the PCP domain occurs via the cofactor 4’-phosphopantetheinyl (4’-Ppant). The 4’-Ppant is added by a phosphopantetheinyl transferase. This reaction involves the transfer of the 4’-Ppant group from coenzyme A to a conserved serine present in the PCP domain, converting the inactive apo-PCP domain into its active holo-PCP domain form (HS-4’-Ppant-PCP) 87, 89, 93, 94. The transfer between catalytic centers of the different domains occurs due to the covalent coupling of the amino acids as thioesters to the free thiol of the 4’-Ppant. Thus, the PCP domain acts mainly as a transport unit. Following covalent bond formation, the peptidyl moiety is transferred to the downstream condensation (C) domain. This domain is localized at the N-terminal of each module and accepts the acyl groups from the upstream module, in order to catalyze peptide bound formation. In addition to the A domain, also the C domain exhibits substrate specificity. Elongation of the peptide chains occurs in two catalytic centers of the C domain: the acceptor site (nucleophile) and the donor site (electrophile). The enzyme catalyzes the nucleophilic attack of the activated peptidyl bound reactive group (amino, imino or hydroxyl) to the downstream module onto the acyl group and condenses the two adjacent amino acids, thereby elongating the
Enlogation module
Initiation module Termination domain
Modification domains Thioesterase Thiolation Adenilation Condensation N-methylation Epimerization
18 peptide chain 88, 92. Accordingly, the number of C domains in an NRPS corresponds to the
number of peptide bounds existing in a linear NRP. During its synthesis, the growing peptide is transferred from module to module for the incorporation of another building block, until the last NRPS module is reached. The release of the mature NRP occurs in the carboxyl-terminal thioesterase (Te) domain, with the cleavage of the protein-peptide (NRPS-NRP) bond. The catalytic action of the Te domain has a strong impact on the peptide primary structure, catalyzing either the hydrolysis or the intramolecular cyclization of the peptidyl chain 95. In addition to these core domains, additional modification domains may be present in certain modules, which leads to the characteristic NRP structure and bioactivity 88. Examples of modification domains include epimerization domains that change D/L amino acid stereochemistry, N-methylation domains that add a methyl group to the α-amino group and heterocyclization domains that catalyze the cyclization of serine, threonine or cysteine residues.
Several non-ribosomal antimicrobial peptides, including the penicillins, have been known for decades. However, the growing list of discovered NRPs and of genes that resemble NRPS in sequenced microbial genomes offer attractive opportunities to discover and develop novel antimicrobial compounds 96. For example, sequencing of the P. chrysogenum genome revealed the presence of 10 NRPS and 15 NRPS-like genes 35.
Exploring the Penicillium chrysogenum genome
The availability of the genome sequence of Penicillium chrysogenum 35 has transformed research on this important industrial microorganisms. Especially after the implementation of more efficient homologous recombination 36, it has become possible to functionally analyze the P. chrysogenum genome and to systematically test the involvement of specific genes and pathways on industrial performance. Moreover, availability of the genome sequence enables the study of the P. chrysogenum transcriptome under different growth conditions, as well as in strains that have been subjected to different genetic interventions profiles 34, 37, 84. Information on which genes are transcribed under specific conditions or in specific genetic contexts is relevant for understanding the influence of process conditions and genetic make-up on cellular physiology. Especially when complemented with physiological information, transcriptome analysis may therefore be a valuable input for the design of metabolic engineering strategies. It should of course be taken into account that mRNA levels represent but one level of cellular information. Ideally, transcriptome analysis should therefore be complemented with analysis at different levels, including the proteome and the metabolome. However, the coverage, reproducibility and price make micro-array-based transcriptomics a logical first approach in genome-wide analysis. The improvement of penicillin production in P. chrysogenum has been, so far, achieved by classic strain improvement, with only a limited role for targeted metabolic engineering approaches.
19
Scope of the thesis
Since Fleming (1929) first demonstrated the production of an antimicrobial agent by Penicillium chrysogenum, its value as an efficient cell factory for the production of β-lactam antibiotics has been well established. The therapeutic value of these antibiotics stimulated extensive physiological and molecular research of penicillin synthesis in P. chrysogenum. Over a period of seven decades, tremendous progress has been made in industrial production, thanks to a combination of classical strain improvement and optimization of fermentation processes and medium composition. With an increase over 1000 fold in penicillin productivity this presents one of the most successful examples of strain improvement in industrial biotechnology 23. The availability of an annotated genome sequence offers exciting possibilities to study the biosynthesis of β-lactams and other NRPs in P. chrysogenum. The aim of this thesis is to explore the use of chemostat-based transcriptome analysis to identify targets for knowledge-chemostat-based metabolic engineering of this important industrial fungus. The emphasis of the work is on increasing the efficiency of side-chain precursor utilization and the elimination of undesirable byproducts.
In several filamentous fungi, including Penicillium and Aspergillus species, the velvet complex plays a major role in the regulation of secondary metabolism. Previous research indicates penicillin biosynthesis in P. chrysogenum is also regulation by the velvet complex. Since previous studies were performed in batch cultures, which bear little resemblance to the conditions in industry, an analysis of the impact of the velvet complex was done in glucose-limited chemostat cultures (Chapter 2). By analysing metabolite production and genome-wide transcript profiles in the penicillin-high-producing strain DS17690 and in isogenic mutants in which the genes encoding the core proteins of the velvet complex (VeA and LaeA) were inactivated, the impact of this complex on secondary metabolite production were quantified.
A deeper understanding of the biosynthesis of side-chain precursors by P. chrysogenum is of interest for understanding penicillin biosynthesis in natural environments, but also for the design of metabolic engineering strategies that enable the synthesis of these precursors from cheap, renewable feedstocks. In Chapter 3, transcriptome analysis, intracellular metabolite measurements and metabolic modelling were used to investigate the pathways for phenylalanine catabolism via the Ehrlich pathway, with an emphasis on pathways leading to the penicillin G side-chain precursor phenylacetic acid (PAA).
The external addition of the side chain precursor is an important cost factor in the production of β-lactam antibiotics. The research presented in Chapter 4 aimed for a more efficient use of side-chain precursor ADA for semi-synthetic cephalosporin synthesis in P. chrysogenum by reducing the rate at which this precursor is degraded by the fungus. To this end, pathways involved in ADA metabolism were investigated by transcriptome analysis of cultures grown in the presence and absence of ADA. Based on the transcriptome data, target genes for metabolic engineering were identified and deleted in
20 the P. chrysogenum genome. Subsequently, the impact of these mutations on ADA
metabolism and production of cephalosporin precursors was investigated.
Oxalate is a well-known but undesirable byproduct of filamentous fungi during growth on glucose. In Chapter 5, the P. chrysogenum genome sequence was used to identify putative genes encoding oxaloacetate hydrolase, the key enzyme in oxalate production. A further prioritization of the resulting candidate genes was obtained by chemostat-based transcriptome analysis under conditions that lead to different productivities of oxalate and, finally, by expressing two candidate genes in the yeast S. cerevisiae (which does not normally produce oxalate). Subsequently, the oxalate hydrolase gene of P. chrysogenum was deleted and the impact of this genetic intervention on growth and product formation was investigated in chemostat cultures.
21
Reference List
1. Lindblad,W.J. Considerations for determining if a natural product is an effective wound-healing agent. The International Journal of Lower Extremity Wounds 7, 75-81 (2008).
2. Waksman,S. What is an antibiotic or an antibiotic substance? Mycologia 39, 565-569 (1947).
3. Fleming,A. On the antibacterial action of cultures of a penicillium, with special reference to their use in the isolation of B. influenzae. Bulletin of the World Health Organization 79, 780-790 (1929).
4. Drews,J. Drug discovery: a historical perspective. Science 287, 1960-1964 (2000).
5. Abraham,E.P. et al. Further observations on penicillin. European Journal of Clinical Pharmacology 42, 3-9 (1941).
6. ScienceWatch.Thomson Scientific & Healthcare. Making Penicillin Possible: Norman Heatley Remembers. 7 A.D. 7. Bellis,M. History of penicillin. http://inventors.about.com/od/pstartinvent ions/a/Penicillin.htm . 2007.
8. Burns,M. & van Dijck,P.W. The development of the penicillin production process in Delft, The Netherlands, during World War II under Nazi occupation.
Advances in Applied Microbiology 51, 185-200 (2002).
9. Burns,M. & van Dijck,P.W. The development of the penicillin production process in Delft, The Netherlands, during World War II under Nazi occupation.
Advances in Applied Microbiology 51, 185-200 (2002).
10. van der Beek,C.P. & Roels,J.A. Penicillin production: biotechnology at its best. Antonie Van Leeuwenhoek 50, 625-639 (1984).
11. Dhar,M.M. & Khan,A.W. Formation of antibiotics. Nature 233, 182-184 (1971).
12. Clardy,J., Fischbach,M., & Currie,C. The natural history of antibiotics. Current biology 19, R437-R441 (2009).
13. Pauli,A. Amica Base Drugs-Online 2011 (Version 8.12.29). 2011. 14. Global Industry Analysts. Antibiotics: A Global Strategic Business Report. 1-850. 2010.
15. IMS Health.
http://www.imshealth.com 2011. 16. Marin,M. & Gudiol,F.
Antibioticos betalactamicos.
Enfermedades infecciosas y microbiologia clinica 21, 42-55 (2003).
17. Barbier,F. & Wolff,M. Multi-drug resistant Pseudomonas aeruginosa: towards a therapeutic dead end? Medecine sciences 26, 960 (2010).
18. Tremolieres,F. When the antibiotic miracle turns into a nightmare. Medecine sciences 26, 925 (2010).
19. Duplessis,C. & Crum-Cianflone,N.F. Ceftaroline: A New Cephalosporin with Activity against Methicillin-Resistant Staphylococcus aureus (MRSA). Clinical medicine reviews in therapeutics 3, (2011).
20. Brakhage,A.A. et al. Regulation of penicillin biosynthesis in filamentous fungi. Molecular Biotechnolgy of Fungal beta-Lactam Antibiotics and Related Peptide Synthetases 88, 45-90 (2004).
22
21. Brakhage,A.A. Molecular regulation of beta-lactam biosynthesis in filamentous fungi. Microbiology and Molecular Biology Reviews 62, 547 (1998).
22. Scott,J., Untereiner,W.A., Wong,B., Straus,N.A., & Malloch,D. Genotypic variation in Penicillium chysogenum from indoor environments.
Mycologia 96, 1095 (2004).
23. Nielsen,J. Physiological engineering aspects of Penicillium chrysogenum(World Scientific Pub Co Inc,1997).
24. d'Enfert,C. Fungal Spore Germination: Insights from the Molecular Genetics of Aspergillus nidulans and
Neurospora crassa. Fungal genetics and Biology 21, 163-172 (1997).
25. Goddard,D.R. The reversible heat activation inducing germination and increased respiration in the ascospores of
Neurospora tetrasperma. The Journal of general physiology 19, 45 (1935).
26. Kasuga,T. et al. Long-oligomer microarray profiling in Neurospora crassa
reveals the transcriptional program underlying biochemical and physiological events of conidial germination. Nucleic acids research 33, 6469 (2005).
27. Martin,J.F., Liras,P., & Villanueva,J.R. Changes in composition of conidia of Penicillium notatum during germination. Archives of Microbiology
97, 39-50 (1974).
28. Paul,G.C., Kent,C.A., & Thomas,C.R. Viability testing and characterization of germination of fungal spores by automatic image analysis.
Biotechnology and bioengineering 42, 11-23 (1993).
29. Paul,G.C. & Thomas,C.R. A structured model for hyphal
differentiation and penicillin production using Penicillium chrysogenum.
Biotechnology and bioengineering 51, 558-572 (1996).
30. Barredo,J.L., Diez,B., Alvarez,E., & MartÆn,J.F. Large amplification of a 35-kb DNA fragment carrying two penicillin biosynthetic genes in high penicillin producing strains of Penicillium chrysogenum. Current genetics 16, 453-459 (1989).
31. Barredo,J.L. et al. Cloning and characterization of the acyl-coenzyme A: 6-aminopenicillanic-aid-acyltransferase gene of Penicillium chrysogenum. Gene
83, 291-300 (1989).
32. Carr,L.G. et al. Cloning and expression of the isopenicillin N synthetase gene from Penicillium chrysogenum. Gene 48, 257-266 (1986). 33. Diez,B. et al. The cluster of penicillin biosynthetic genes. Identification and characterization of the
pcbAB gene encoding the alpha-aminoadipyl-cysteinyl-valine synthetase and linkage to the pcbC and penDE genes.
Journal of Biological Chemistry 265, 16358 (1990).
34. Harris,D.M. et al. Engineering of
Penicillium chrysogenum for fermentative production of a novel carbamoylated cephem antibiotic precursor. Metabolic engineering 11, 125-137 (2009).
35. van den Berg,M.A. et al. Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nat Biotechnol 26, 1161-1168 (2008).
36. Snoek,I.S.I. et al. Construction of an hdfA Penicillium chrysogenum strain impaired in non-homologous end-joining and analysis of its potential for functional analysis studies. Fungal genetics and Biology 46, 418-426 (2009).
23
37. Harris,D. et al. Exploring and dissecting genome-wide gene expression responses of Penicillium chrysogenum to phenylacetic acid consumption and penicillinG production. BMC genomics
10, 75-95 (2009).
38. Koetsier,M.J. et al. The
Penicillium chrysogenum aclA gene encodes a broad-substrate-specificity acyl-coenzyme A ligase involved in activation of adipic acid, a side-chain precursor for cephem antibiotics. Fungal genetics and Biology 47, 33-42 (2010).
39. Fierro,F. et al. The penicillin gene cluster is amplified in tandem repeats linked by conserved hexanucleotide sequences. Proceedings of the National Academy of Sciences 92, 6200-6204 (1995).
40. Newbert,R.W., Barton,B., Greaves,P., Harper,J., & Turner,G. Analysis of a commercially improved
Penicillium chrysogenum strain series: involvement of recombinogenic regions in amplification and deletion of the penicillin biosynthesis gene cluster. Journal of industrial microbiology & biotechnology
19, 18-27 (1997).
41. Schmitt,E.K., Hoff,B., & Knck,U. Regulation of cephalosporin biosynthesis.
Molecular Biotechnolgy of Fungal beta-Lactam Antibiotics and Related Peptide Synthetases1-43 (2004).
42. Rodriguez-Saiz,M., Diez,B., & Barredo,J.L. Why did the Fleming strain fail in penicillin industry? Fungal genetics and Biology 42, 464-470 (2005).
43. Lein,J. The Panlabs penicillin strain improvement program.
Biotechnology Series105-139 (1986). 44. Backus,M.P. & Stauffer,J.F. The production and selection of a family of strains in Penicillium chrysogenum.
Mycologia 47, 429-463 (1955).
45. Barredo,J.L., Diez,B., Alvarez,E., & MartÆn,J.F. Large amplification of a 35-kb DNA fragment carrying two penicillin biosynthetic genes in high penicillin producing strains of Penicillium chrysogenum. Current genetics 16, 453-459 (1989).
46. Smith,D.J., Bull,J.H., Edwards,J., & Turner,G. Amplification of the isopenicillin N synthetase gene in a strain of Penicillium chrysogenum producing high levels of penicillin. Molecular and General Genetics MGG 216, 492-497 (1989).
47. Fierro,F. et al. Transcriptional and bioinformatic analysis of the 56.8 kb DNA region amplified in tandem repeats containing the penicillin gene cluster in Penicillium chrysogenum. Fungal genetics and Biology 43, 618-629 (2006).
48. Penalva,M.A., Rowlands,R.T., & Turner,G. The optimization of penicillin biosynthesis in fungi. Trends in biotechnology 16, 483-489 (1998).
49. Rodriguez-Saiz,M. et al. Reduced function of a phenylacetate-oxidizing cytochrome p450 caused strong genetic improvement in early phylogeny of penicillin-producing strains. Journal of Bacteriology 183, 5465 (2001).
50. Mingot,J.M., Penalva,M.A., & Fernandez-Canon,J.M. Disruption of
phacA, an Aspergillus nidulans gene encoding a novel cytochrome P450 monooxygenase catalyzing phenylacetate 2-hydroxylation, results in penicillin overproduction. Journal of Biological Chemistry 274, 14545-14550 (1999). 51. Boon,W.R., Calam,C.T., Gudgeon,H., & Levi,A.A. Penicillin: analysis of the crude product by partition chromatography. 2. Chromatographic analysis of the penicillins from two strains of Penicillium notatum. Biochemical Journal 43, 262-265 (1948).
24
52. Moyer,A.J. & Coghill,R.D. Penicillin: VIII. Production of penicillin in surface cultures. Journal of bacteriology 51, 57-78 (1946).
53. Moyer,A.J. & Coghill,R.D. Penicillin: IX. The laboratory scale production of penicillin in submerged cultures by Penicillium notatum Westling
(NRRL 832). Journal of bacteriology 51, 79-93 (1946).
54. Stone,R.W. & Farrell,M.A. Synthetic media for penicillin production.
Science 104, 445-446 (1946).
55. Liggett,R.W. & Koffler,H. Corn steep liquor in microbiology.
Microbiology and Molecular Biology Reviews 12, 297-331 (1948).
56. van den Berg,M.A. et al. Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nature Biotechnology 26, 1161-1168 (2008).
57. Turgay,K., Krause,M., & Marahiel,M.A. Four homologous domains in the primary structure of GrsB are related to domains in a superfamily of adenylate forming enzymes. Molecular microbiology 6, 529-546 (1992).
58. Minambres,B. et al. Molecular cloning and expression in different microbes of the DNA encoding Pseudomonas putida U phenylacetyl-CoA ligase. Use of this gene to improve the rate of benzylpenicillin biosynthesis in
Penicillium chrysogenum. Journal of Biological Chemistry 271, 33531-33538 (1996).
59. Macmorine,H.G. Some factors influencing the production of certain biosynthetic penicillins. Applied and Environmental Microbiology 5, 386-3891 (1957).
60. Thorn,J.A. & Johnson,M.J. Precursors for Aliphatic Penicillins.
Journal of the American Chemical Society
72, 2052-2058 (1950).
61. Arnstein HR & Grant PT The metabolism of the Penicillia in relation to penicillin biosynthesis. Bacteriol. Rev. 20, 133-147 (1956).
62. Koetsier,M.J., Jekel,P.A., van den Berg,M.A., Bovenberg,R.A.L., & Janssen,D.B. Characterization of a phenylacetate-CoA ligase from
Penicillium chrysogenum. Biochemical Journal 417, 467-476 (2008).
63. Robinson,F.A. Chemistry of penicillin. Analyst 72, 274-276 (1947). 64. Committee on Medical Research,O.S.R.D.W. & Medical Research Council,L. Chemistry of penicillin. Scienc 102, 629 (1945).
65. Gordon,M., Pan,S.C., Virgona,A., & Numerof,P. Biosynthesis of penicillin. I. Role of phenylacetic acid. Science 118, 43 (1953).
66. Henriksen,C.M., Nielsen,J., & Villadsen,J. Modelling of the protonophoric uncoupling by phenoxyacetic acid of the plasma membrane potential of Penicillium chrysogenum. Biotechnol. Bioeng. 60, 761-767 (1998).
67. Hillenga,D.J., Versantvoort,H., van der Molen,S., Driessen,A., & Konings,W.N. Penicillium chrysogenum
takes up the penicillin G precursor phenylacetic acid by passive diffusion.
Applied and Environmental Microbiology
61, 2589-2595 (1995). 68. Fernandez-Canon,J.M.,
Reglero,A., Martinez-Blanco,H., Ferrero,M.A., & Luengo,J.M. Phenylacetic acid transport system in
25
molecular specificity of its induction.
Journal of Antibiotics 42, 1410-1415 (1989).
69. Eriksen,S.H., Soderblom,T.B., Jensen,B., & Olsen,J. Uptake of phenylacetic acid by two strains of
Penicillium chrysogenum. Biotechnology and bioengineering 60, 310-316 (1998). 70. Lamas-Maceiras,M., Vaca,I., Rodriguez,E., Casqueiro,J., & Martin,J.F. Amplification and disruption of the phenylacetyl-CoA ligase gene of
Penicillium chrysogenum encoding an aryl-capping enzyme that supplies phenylacetic acid to the isopenicillin N-acyltransferase. Biochemical Journal 395, 147-155 (2006).
71. Gledhil L, Greaves PA, & Griffin JP. A process for preparing an enzyme for
Penicillium chrysogenum having phenylacetate-CoA activity. [WO 97/02349]. 1997.
72. Gledhill,L., Greaves,P.A., & Griffin,J.P. Phenylacetyl-CoA ligase from
Penicillium chrysogenum. [U.S. Patent 6,245,524]. 2001. Google Patents. 73. Brunner,R. & Rohr,M. Phenacyl:
Coenzyme A ligase. Methods in
Enzymology 43, 476-481 (1975).
74. Kogekar,R.G. & Deshpande,V.N. Biosynthesis of penicillin in vitro: purification & properties of phenyl/phenoxyacetic acid activating enzyme. Journal of Biochemestry and Biophys 20, 208-212 (1982).
75. Wang,F.Q. et al. Molecular cloning and functional identification of a novel phenylacetyl-CoA ligase gene from
Penicillium chrysogenum. Biochemical and biophysical research communications
360, 453-458 (2007).
76. El-Said Mohamed,M. Biochemical and molecular characterization of phenylacetate-coenzyme A ligase, an enzyme catalyzing the first step in aerobic metabolism of phenylacetic acid in
Azoarcus evansii. Journal of bacteriology
182, 286-294 (2000).
77. Martinez-Blanco,H., Reglero,A., Rodriguez-Aparicio,L.B., & Luengo,J.M. Purification and biochemical characterization of phenylacetyl-CoA ligase from Pseudomonas putida. A specific enzyme for the catabolism of phenylacetic acid. Journal of Biological Chemistry 265, 7084-7090 (1990).
78. Arias-Barrau,E. et al. The homogentisate pathway: a central catabolic pathway involved in the degradation of phenylalanine, L-tyrosine, and 3-hydroxyphenylacetate in
Pseudomonas putida. Journal of bacteriology 186, 5062-5077 (2004).
79. Ferrer-Sevillano,F. & Fernandez-Canon,J.M. Novel phacB-encoded cytochrome P450 monooxygenase from
Aspergillus nidulans with 3-hydroxyphenylacetate 6-hydroxylase and 3, 4-dihydroxyphenylacetate 6-hydroxylase activities. Eukaryotic Cell 6, 514-520 (2007).
80. Crawford,L. et al. Production of cephalosporin intermediates by feeding adipic acid to recombinant Penicillium chrysogenum strains expressing ring expansion activity. Biotechnology 13, 58-62 (1995).
81. Martin,J.F. et al. Expression of genes and processing of enzymes for the biosynthesis of penicillins and
cephalosporins. Antonie van
Leeuwenhoek 65, 227-243 (1994). 82. Robin,J., Jakobsen,M., Beyer,M., Noorman,H., & Nielsen,J. Physiological characterisation of Penicillium chrysogenum strains expressing the
26
expandase gene from Streptomyces clavuligerus during batch cultivations. Growth and adipoyl-7-aminodeacetoxycephalosporanic acid production. Applied microbiology and biotechnology 57, 357-362 (2001).
83. Schroen,C.G. et al. Process design for enzymatic adipyl-7-ADCA hydrolysis.
Biotechnology Progress 18, 745-751 (2002).
84. Harris,D.M. et al. Engineering of
Penicillium chrysogenum for fermentative production of a novel carbamoylated cephem antibiotic precursor. Metabolic Engineering 11, 125-137 (2009).
85. Thykaer,J., Christensen,B., & Nielsen,J. Metabolic network analysis of an adipoyl-7-ADCA-producing strain of
Penicillium chrysogenum: elucidation of adipate degradation. Metabolic Engineering 4, 151-158 (2002).
86. Schwarzer,D. & Marahiel,M.A. Multimodular biocatalysts for natural product assembly. Naturwissenschaften
88, 93-101 (2001).
87. Schwarzer,D., Finking,R., & Marahiel,M.A. Nonribosomal peptides: from genes to products. Natural product reports 20, 275-287 (2003).
88. Finking,R. & Marahiel,M.A. Biosynthesis of nonribosomal peptides.
Annu. Rev. Microbiol. 58, 453-488 (2004).
89. Stack,D., Neville,C., & Doyle,S. Nonribosomal peptide synthesis in Aspergillus fumigatus and other fungi.
Microbiology 153, 1297 (2007).
90. Sieber,S.A. & Marahiel,M.A. Learning from nature's drug factories: nonribosomal synthesis of macrocyclic peptides. Journal of Bacteriology 185, 7036 (2003).
91. Mootz,H.D. & Marahiel,M.A. The tyrocidine biosynthesis operon of Bacillus brevis: complete nucleotide sequence and biochemical characterization of functional internal adenylation domains. Journal of Bacteriology 179, 6843-6850 (1997). 92. Weber,T. & Marahiel,M.A. Exploring the domain structure of modular nonribosomal peptide synthetases. Structure 9, R3-R9 (2001).
93. Lambalot,R.H. et al. A new
enzyme superfamily-the phosphopantetheinyl transferases.
Chemistry & Biology 3, 923-936 (1996). 94. Lautru,S. & Challis,G.L. Substrate recognition by nonribosomal peptide synthetase multi-enzymes. Microbiology
150, 1629-1636 (2004).
95. Marahiel,M.A., Stachelhaus,T., & Mootz,H.D. Modular peptide synthetases involved in nonribosomal peptide synthesis. Chemical reviews 97, 2651-2674 (1997).
96. Hancock,R.E.W. Peptide antibiotics. The lancet 349, 418-422 (1997).
Impact of Velvet complex on transcriptome and penicillin
G production in glucose-limited chemostat cultures of a
β
-lactam high-producing
Penicillium chrysogenum
strain
Tânia Veiga, Jeroen G. Nijland, Arnold J. Driessen, Roel A. L. Bovenberg,
Hesselein Touw, Marco A. van den Berg, Jack T. Pronk, Jean-Marc Daran
OMICS 2012 [Epub ahead of print]
Chapter 2
29
Abstract
The multi-component global regulator Velvet complex has been identified as a key regulator of secondary metabolite production in Aspergillus and Penicillium species. Previous work indicated a massive impact of PcvelA and PclaeA deletions on penicillin production in prolonged batch cultures of P. chrysogenum, as well as substantial changes in transcriptome. The present study investigated the impact of these mutations on product formation and genome-wide transcript profiles under glucose-limited aerobic conditions, relevant for industrial production of β-lactams. Predicted amino acid sequences of PcVelA and PcLaeA in this strain were identical to those in its ancestor Wisconsin54-1255. Controls were performed to rule out transformation-associated loss of penicillin-biosynthesis clusters. The correct PcvelA and PclaeA deletion strains revealed a small reduction of penicillin G productivity relative to the reference strain, which is a much smaller reduction than previously reported for prolonged batch cultures of similar P. chrysogenum mutants. Chemostat-based transcriptome analysis yielded only 32 genes with a consistent differential response in the PcvelAΔ and PclaeAΔ mutants when grown in the absence of the penicillin G side-chain precursor PAA. 11 of these genes belonged to two small gene clusters, one of which contained a gene with high homology to the aristolochene synthase. These results provide clear caveat that the impact of the Velvet complex on secondary metabolism in filamentous fungi is context dependent.
Background
Ascomycetous filamentous fungi produce a large range of structurally diverse, complex low-molecular-weight compounds known as secondary metabolites. Secondary metabolites are generally non-essential for survival and highly species or even strain specific 1 but may positively affect growth, physiology or reproduction of the producing organism 2-5. In addition, several fungal secondary metabolites are of applied interest, e.g. because of their role as toxins or their application as antibiotics 6-8.
The genes involved in fungal secondary metabolic pathways share a tendency towards physical clustering, with a preference for subtelomeric regions 9, 10. Evidence is mounting that this spatial organization contributes to regulation of these pathways. Subtelomeric gene regulation was observed in Aspergillus parasiticus, in which chromosomal translocation of a secondary metabolite gene cluster resulted in deregulated expression 11. Expression of the A. parasiticus ver-1 and nor-1 genes, involved in aflatoxin biosynthesis, was shown to depend strongly on chromosomal localization, thereby revealing a cellular strategy for activation or repression of entire biosynthetic gene clusters 12, 13. Over the past years, several reports established epigenetic regulation of cryptic secondary metabolite clusters, in which co-expression of the clustered genes was directly affected by chromosomal remodeling. In A. nidulans, deletion of cclA, a BRE2 ortholog involved in histone H3 lysine 4 methylation, resulted in activation of the expression of secondary metabolite clusters 14.
30 The Velvet complex, an intensively studied multi-component global regulator, is
involved in morphogenesis as well as in the regulation of a wide range of secondary metabolite pathways in filamentous fungi 15, 16. In A. nidulans, the core of the complex is composed of three subunits VeA, VelB and LaeA 15. The Velvet protein VeA has been identified as a positive transcriptional regulator of genes involved in secondary metabolism and as a negative regulator of asexual development 17-19. LaeA is a methyltransferase involved in activation of secondary metabolism genes through epigenetic control 1, 15, 20. VelB, a VeA-like protein seems to be necessary for recruiting the regulator of sporogenesis VosA. Through VeA, the complex interacts with light responsive proteins, FhpA, LreA and LreB or the α-importin KapA 15.
Orthologs of the Velvet complex components in several fungi show a conservation of amino acid sequence and function, but also some degree of flexibility 21, 22. In P. chrysogenum, PclaeA and PcvelA knock-down mutants have been constructed in two strain backgrounds with different penicillin biosynthesis ability: Wisconsin54-1255 (an early strain in the improvement program) and P2niaD (a penicillin high-producing strain derived from the Panlabs strain improvement program) 23. The PclaeA deletion resulted in transcriptional down-regulation of all genes involved in penicillin biosynthesis and a drastic reduction of penicillin production (by circa 80%) 16, 22. Deletion of PcvelA in the high-producing strain had a similar impact 22. Moreover, transcriptome analysis of PclaeA and PcvelA deletions in strain P2niaD revealed a widespread impact, with over 10 % of the genome being affected by these deletions, with a clear overrepresentation of genes involved in secondary metabolite pathways and in fungal development 22. These observations are in line with studies on other filamentous fungi, in which deletion of veA or laeA was similarly shown to lead to down-regulation of the production of several secondary metabolites 19, 21, 24, 25.
Previous studies on the impact of the Velvet complex in P. chrysogenum were performed in prolonged batch cultures. Time course analysis revealed that the impact of PcvelA and PclaeA mutations was most pronounced after prolonged incubation 22, but the physiological status of these cultures was not precisely defined. Industrial production of β-lactam antibiotics is performed in sugar-limited, aerobic fed-batch cultures 26.
The aim of the present study is to investigate the impact of the Velvet complex on physiology, penicillin production and transcriptional regulation under industrially relevant conditions. To this end, we studied the impact of PcvelA and PclaeA deletions in aerobic, glucose-limited chemostat cultures of the penicillin high-producing strain P. chrysogenum DS17690.
31
Methods Strains
Penicillium chrysogenum strains used in this study are listed in Table 1. DS17690 is a high penicillin producing strain, resulting from the DSM classical strain improvement program (DSM Anti-Infectives, Delft, The Netherlands). P. chrysogenum strains DS63171 (PcvelA∆) and DS67261 (PclaeA∆) were derived from strain DS54465 (hdfA∆) 27, which has a high frequency of homologous recombination. Requests for academic use of the P. chrysogenum strains, under a material transfer agreement, should be addressed to Prof. R.A.L. Bovenberg (DSM Anti-Infectives, P.O. Box 425, Delft NL-2600 AK, The Netherlands).
Table 1 - P. chrysogenum strains used in this study.
Strain Genotype Reference
DS17690 High penicillin producer 28
Wisconsin54-1255/ATCC28089 Ancestor of DS17690 29
DS54465 hdfA∆ 27
DS50652 [pcbAB-pcbC-penDE]∆ 30
DS63171 hdfA∆ Pc13g13200/PcvelA∆-amdS This work
DS67261 hdfA∆ Pc16g14010/PclaeA∆-amdS This work
Deletion cassette construction
All P. chrysogenum gene fragments were amplified from genomic DS17690 DNA using Phusion Hot-Start polymerase (Finnzymes, Landsmeer, The Netherlands). Vector pDONRTM P4-P1R (Invitrogen, Breda, The Netherlands) was used to clone the 782-bp 5’-flanking region of the Pc16g14010 (PclaeA) gene. This fragment was PCR amplified with primers attB4F5 Pc16g14010HindIII and attB1R4 Pc16g14010 (Table 2).
The vector and the fragment were recombined with BP clonases (Invitrogen, Breda, The Netherlands) yielding pDONR41-5’FR 16g14010. pDONRTM P2-P3R (Invitrogen, Breda, The Netherlands) was used to clone the 981-bp 3’-flanking region of the Pc16g14010 gene. This fragment was PCR amplified with the primer pair attB2F Pc16g14010/attB3R Pc16g14010 HindIII (Table 2). The vector and the fragment were recombined with BP clonase yielding pDONR23-3’FR 16g14010. pDONRTM 221 gateway vector (Invitrogen, Breda, The Netherlands) was used to clone the A. nidulans acetamidase-gene (amdS) gene under control of the A. nidulans gpdA promoter and penDE terminator which were amplified from plasmid pBlueAMDS 30 with primers attB1F AMDS and attB2R AMDS (Table 2). The three fragments were then combined with the pDESTTM P4-R3 in the LR reaction of the Multisite GatewayTM Three-Fragment Vector Construction Kit (Invitrogen, Breda, The Netherlands) resulting in the destination vector (pDest43-KO 16g14010). This vector contains flanking HindIII
32 restriction sites that were used to cut out the deletion cassette. The Pc16g14010/PclaeA
deletion cassette was transformed in DS54465 (hdfA∆) protoplasts using the acetamidase gene (amdS) as selection marker 31, resulting in strain DS63171 (PclaeA∆).
33
Table 2 - Primers used in this study.
Primer Sequence (5’ 3’)
attB4F5 Pc16g14010HindIII GGGGACAACTTTGTATAGAAAAGTTGAAGCTTCAACCTCTAGTTACCGGTAGCGCG attB1R4 Pc16g14010 GGGGACTGCTTTTTTGTACAAACTTGGCGTTCGAGGCGTGGGATGCCTG
attB2F Pc16g14010 GGGGACAGCTTTCTTGTACAAAGTGGGTGAAGCATAGCAATCGACCGCC attB3R Pc16g14010 HindIII GGGGACAACTTTGTATAATAAAGTTGGTTGGTCTACAATCCGGCGTTGGG attB1F AMDS GGGGACAAGTTTGTACAAAAAAGCAGGCTCGCAGGAATTCGAGCTCTGTAC attB2R AMDS GGGGACCACTTTGTACAAGAAAGCTGGGTCTCGCTCGTACCATGGGTTGAG F-amds GAAAGTCCAGACGCTGCCTGCG
R-amds CCCTGGTGGCATATGTTAGCTG F14010 GTGCTATGGCTAACTGGTACTCG R14010 TTTCGCGCTTGATAGATGTGCAG F γ-actin gDNA TTCTTGGCCTCGAGTCTGGCGG R γ-actin gDNA GTGATCTCCTTCTGCATACGGTCG F-IGR Pc20g07090 GTTCCTATAGGACGTAGCTCCGC R-IGR Pc20g07090 AAATCAGCTCTACTAGCGATCCGC F-pcbAB CACTTGACGTTGCGCACCGGTC R-pcbAB CTGGTGGGTGAGAACCTGACAG F-pcbC AGGGTTACCTCGATATCGAGGCG R-pcbC GTCGCCGTACGAGATTGGCCG PVF CCTTCGCCGACTGAGGAGTACGGAGTAGCTTGCGGTGACTTTCATTC PVR TCTTAGACGCTCCGGAGCATAGAAGTTTCGCGGATTGATGTTGTTATTCCCAGATATTC OVF ATGGCCAACAGACCATCTCTCATGCCACCTC OVR CCTTCGCCGACTGATGTACTCGACGGAGGAGCTTTCATGACTAT TTT A3F TTTTTGTCAAGCTTACATATGCCACCAGGGCTAC A3R ATGGATGGATCCATAACTTCGTATAATGTATGCTATACGAAGTTATGTTGAGTGGTATGGG GCCATCC A5F CTGGAATTGTTTAAACGCGGCCGCCGCCTGCAGGATAACTTCGTATAGCATACATTATACG AAGTTATGACTCTTTCTGGCATGCGGAGAGAC A5R TTCTGGAGAAGCTTGTCCCAGAGCTCGTTCATGTTAACAG TCF CGAGGAGCACCTGCAGGCCGACGCCGACCAACACCGCC TCR CCGCCAGTGTTTAAACTAGCGGCCGCATGGCGCGCCGTATTGGGTGTTACGGAGCATTCAC TWF TGCAGCGCGTTAGAATAC TWR CGGATCCTTCGCCGACTGA F13g13200 CAGTACCGAGTCCATGTATGCCGGG R13g13200 GGGGGAAGTTTGTTGTGGTACCTGG RTamdS GCCACAGGTGACTCTGGATGG FpgdA GTCTCTCCGCATGCCAGAAAG veA Fw CACCATGGCCAACAGACCATCTCTCATGC veA Rv TTATGTACTCGACGGAGGAGCTTTC LaeA Fw CACCATGTCTTACCGAGAGTCATCTGGTTCCTTTC LaeA Rv TTATTCCTCGACTGGTTTTCGCGCTTG
