Morphine-induced place preference affects mRNA expression of G protein a subunits in rat brain

(1)

Morphine-induced place preference affects mRNA expression of G protein a subunits in rat brain

Agnieszka Zelek-Molik¹, Adam Bielawski¹, Grzegorz Kreiner¹, Piotr Popik², Jerzy Vetulani¹, Irena Nalepa¹

1Department of Brain Biochemistry and²Department of Behavioral Neuroscience and Drug Development, Institute of Pharmacology, Polish Academy of Science, Smêtna 12, PL 31-343 Kraków, Poland

Correspondence: Irena Nalepa, e-mail: nfnalepa@cyf-kr.edu.pl

Abstract:

Background: The conditioned place preference (CPP) test is an animal model serving to assess addictive potential of drugs in which environmental cues become associated with the subjective effects of drugs of abuse. Morphine, a known addictive drug, is an agonist of opioid receptors that couple to the G(i/o) family of guanine nucleotide-binding proteins (GP). We have recently found that chronic treatment with morphine affects mRNA levels of GPs that are not coupled to opioid receptors (OR). Therefore, in this study, we in- vestigated the influence of morphine-induced CPP on mRNA expression of the Ga subunits, G(i/o), G(s), G(q/11), and G(12), in the rat prefrontal cortex (PFC) and nucleus accumbens (NAc) using standard PCR techniques.

Methods: CPP and NO-CPP experiments were conducted; Wistar rats were either subjected to the standard CPP procedure or were injected with morphine (or saline) in their home cage. All rats were decapitated 24 h after the last injection.

Results: We found that mRNA levels of Ga(q), Ga(11) and Ga(12) were increased after morphine in non-conditioned treatment in the PFC but remained unchanged in the NAc. In rats showing conditioned place preference to morphine, levels of Ga(i2) in the PFC and levels of Ga(oA) in the NAc were diminished by ~58% and ~30%, respectively (p < 0.05 vs. saline), but levels of Ga(s-l) in NAc were increased (~60%, p = 0.05).

Conclusion: Our data indicate that only G(i/o) and G(s) were specifically changed in animals after morphine-induced CPP, thus sug- gesting that the effect was related to learning environmental cues associated with morphine.

Key words:

conditioned place preference, Ga subunits mRNA, morphine, nucleus accumbens, prefrontal cortex

Abbreviations: AC – adenylyl cyclase, AMV – avian myelo- blastosis virus (reverse transcriptase), cAMP – cyclic AMP, CPP – conditioned place preference, GABA – g-aminobutyric acid, GP – heterotrimeric guanine nucleotide binding proteins, HPRT – hypoxanthine-guanine phosphoribosyltransferase, MAPK – mitogen-activated protein kinase, NAc – nucleus accumbens, OR – opioid receptor, PFC – prefrontal cortex, PKA – protein kinase A, PKC – protein kinase C, SEM – standard error of the mean

Introduction

Conditioned place preference (CPP) is an animal model serving to assess addictive potential of drugs in which the subjective effects of drugs become associated with initially neutral conditioned stimuli [25].

Because conditioned cues can motivate drug taking

Pharmacological Reports 2012, 64, 546557 ISSN 1734-1140

(2)

and trigger craving and withdrawal symptoms in opiate addiction, the identification of molecular and cellular mechanisms that underlie CPP-associated learning is of crucial importance for understanding addictive behaviors.

Addiction is thought to occur when addictive sub- stances usurp the neuronal processes responsible for reward-related learning (see [10]) Accordingly, opioids mimic endogenous endorphins, crucial physiological regulators of reward mechanisms that act via µ and d opioid receptors (OR), which are widely distributed throughout reward areas of the brain [13]. Morphine exhibits higher affinity for µ OR [13] – the receptor responsible for the rewarding and withdrawal effects of morphine activity [14], than the d OR. µ ORs are ex- pressed on noradrenergic [39], serotonergic [32], gluta- matergic [46] and g-aminobutyric acid (GABA) [6]

neurons, and their activation may modulate the activity and release of many different neurotransmitters [42].

The well-known mechanism underlying the reinforcing actions of morphine involves stimulation of µ ORs on GABA neurons in the ventral tegmental area, which results in the inhibition of GABA release followed by the disinhibition of dopaminergic neurons and the increased secretion of dopamine in the nucleus accumbens (NAc) [22].

µ ORs are metabotropic receptors that transmit sig- nals via heterotrimeric guanine nucleotide binding proteins (GP). Structurally, GP are composed of Ga and Gbg functional subunits [21]. Signal specificity is determined primarily by the specific Ga subunit that interacts with the stimulated receptor [43]. Based on the sequence homology of Ga subunits, GPs can be divided into four main families involved in different signaling pathways: Gs (stimulating adenylyl cyclase (AC)), G(i/o) (inhibiting AC), G(q/11) (stimulating phospholipase Cb (PLC)) and G(12) (modulating the activity of so-called small G proteins, e.g., Rho protein) [12]. Using the above effectors, GP regulate important metabolic enzymes and ion channels and influence the GTPase-regulated activation of MAPK signal pathways, which can change transcriptional machinery [23]. Although OR are coupled to G(i/o) family members, we have recently found that chronic treatment with morphine also induces changes in the mRNA levels of Ga(11), Ga(q) and Ga(12) subunits in selected regions of rat brain [18].

The current study was designed to determine whether morphine-induced CPP has any influence on the mRNA levels of Ga subunits in the PFC and NAc. Moreover, in order to distinguish between the direct pharmacological

effects of morphine and indirect effects resulting from morphine-induced CPP, mRNA levels were also assessed in rats that received morphine but were not subjected to the conditioning procedure.

Materials and Methods

Animals

Male Wistar rats (weighing 300 g at the beginning of the experiment) were obtained from our Institute Breeding Facility and were housed and handled for at least 2 weeks before experiments started. Animals were kept under standard colony conditions (housed 3 to a cage; 20–22°C; 12-h light/dark cycle) with food and water available ad libitum.

The experimental protocols were in compliance with the European Communities Council directive (86/609/EEC) and were approved by the Committee for Laboratory Animal Welfare and Ethics at the Institute of Pharmacology, Polish Academy of Sciences, Kraków.

Drugs

Morphine HCl (Polfa, Kutno, Poland) was dissolved in physiological saline. Saline was used as a placebo.

All injections were given in a volume of 1 ml/kg, ip.

Behavioral procedures

CPP-rats were subjected to a standard morphine- induced CPP procedure. NO-CPP-rats were subjected to an injection regimen identical to the CPP rats except that injections were administered in home cages and the CPP procedure was omitted.

Induction of CPP

The CPP procedure was similar to that described previously [26]. Four identical wooden boxes with white and black chambers (30 × 20 × 25 cm each) were used. The chambers had distinct floor textures (plain wood in the white chamber and wire mesh in the black chamber). The gray central area (12 × 20 × 25 cm) constituted a “neutral” chamber. Experiments were carried out according to standard CPP procedure and consisted of four phases: adaptation, pretest, acquisition of a conditioned response and the post-test.

(3)

During the first 3 days of training (adaptation phase), the rats were placed individually in the apparatus for free exploration for 10 min daily. On day 4 (pre-test), the time spent in the white chamber during a 10-min free exploration session was measured and recorded.

This measure was used as an initial preference score for each subject. On days 5, 7 and 9, rats were injected with placebo 15 min before being placed in the black chamber of the apparatus for a trial lasting 30 min. On days 6, 8, and 10, rats were injected with morphine (1 mg/kg) 15 min before being placed in the white (non-preferred) chamber for a trial lasting 30 min. These 6 consecutive days served as conditioning trials. Changes in the CPP scores were measured on day 11 (post-test), when rats were injected with placebo 15 min before being placed in the apparatus. Again, the time spent in the white chamber was recorded during the 10-min session. Control rats received an equal number of saline injections before being placed in the black or white chamber of apparatus.

The final score was calculated for each rat as the dif- ference between the post-test and pre-test score in the drug-paired compartment.

Morphine injections without induction of CPP (NO-CPP) procedure

In a parallel experiment, a similar schedule of morphine and saline injections was applied to two additional groups of rats that did not undergo the CPP procedure and were kept in their home cages during the entire experiment.

Brain dissection

Rats were decapitated 24 h after the last morphine injection. Brains were rapidly removed and placed on an ice-cold porcelain plate. Prefrontal cortex (PFC) and NAc were removed as previously described [18]. Tis- sue samples were frozen in liquid nitrogen and kept at –70°C until use.

Analysis of Ga subunits’ mRNA expression

RNA isolation

Tissues were homogenized using a glass Teflon ho- mogenizer (Glas-Col, Terra Haute), and total tissue RNA was isolated using 1 ml of TRIzol reagent (Invi- trogen) according to the manufacturer’s protocol. The

quantity of RNA was determined spectrophotometri- cally at 260 nm and 260 nm/280 nm (Pharmacia Ultraspec 2000 UV/Vis, Pharmacia Biotech), and its quality was confirmed by electrophoresis on agarose (Amresco) gel.

Primer design for PCR

Primers were based upon the sequences retrieved from the NCBI GenBank database and were designed using OLIGO Primer Analysis Software (version 5.0, NBI) (sequences listed in Tab. 1). To rule out genomic DNA contamination in the PCR amplification, the primers were chosen in different exons of each gene.

For the assessment of Ga(i1), Ga(i2), Ga(i3) mRNA expression, a set of degenerate primers was used as described in detail previously [29]. These primers am- plified cDNA fragments of equal length for Ga(i1) and Ga(i3) transcripts (503 base pairs (bp)) and a 506-bp segment of Ga(i2) mRNA. All primers were custom synthesized and purchased from TIB Molbiol.

Synthesis of complementary DNA (cDNA) from RNA – reverse transcription (RT)

Total RNA from each sample (NAc – 0.6 µg and PFC – 1.5 µg for Ga(o), Ga(s), Ga(12), Ga(q), Ga(11) mRNA and for Ga(i) mRNA 1 µg (NAc) – 2 µg (PFC)) was reverse transcribed into cDNA in a total volume of 20 µl. Briefly, total RNA was incubated for 5 min at 65°C with 2 U of RNase inhibitor (Fermen- tas) and 6 µl RNase-free water, and the samples were chilled on ice. Then, 5 × AMV Reverse Transcriptase Buffer (Finnzymes), 1 µM of each specific 3’ primer (for each Ga subunit and the housekeeping genes b-actin and hypoxanthine-guanine phosphoribosyltrans- ferase, HPRT),1 mM dNTP Mix (Fermentas), and 10 U AMV Reverse Transcriptase (Finnzymes) (brought to a final volume of 10 µl with RNase-free water) were added before incubation steps of 90 min at 42°C and 10 min at 70°C. cDNAs for all genes except Ga(i) were synthesized in a one-tube reaction. The RT products were stored at –20°C until further use.

Amplification of cDNA–polymerase chain reaction (PCR)

A 2 µl volume of the RT product (RT solution containing cDNA) was amplified by PCR with sense and antisense primers. cDNAs for Ga(q), Ga(11), and

(4)

Ga(12) were simultaneously amplified using multi- plex PCR as previously described [18]. No competi- tion between primer pairs and individual PCR products was observed. Separate reactions were performed for other genes. The reaction mixture was composed of 1 × PCR buffer (Finnzymes), 0.2 mM dNTP (Fer- mentas), 0.4 µM 5’-primer, 0.4 µM 3’-primer, and 0.5 U of DyNAZymeII DNA polymerase (Finnzymes).

The incubation parameters and number of cycles for each gene are listed in Table 2.

Restriction enzyme digestion of Ga(i) mRNA

In order to distinguish the products of separate Ga(i) genes, PCR reaction products were digested with the restriction endonuclease, Pst l. The digestion reaction mixture was composed of 1 × buffer 0+ (Fermentas), 3 U Pst l restriction endonuclease (Fermentas), and 20 µl of PCR product. Samples were then incubated at 37°C for 18 h. Restriction fragments of Ga(i) cDNA of different lengths were separated by polyacrylamide

Tab. 1. Sequence of primers for PCR

Primer name¹ Left primer Right primer Transcript length [bp]

Ga(12) NM_031034

776-TTCCAGTGCTTCGACGGGA 369

Ga(q) NM_031036

997²-GAAGCGGATGTTCTCGGTGTC 744-GGAGGAGAGCAAAGCACTCTTTA 274

Ga(11) AF239674

828-GGACCTTCTGGAAGACAAGATCC 190

Ga(o) M17526

1880–TTACAAAGGCCAAAGGTCAT 1491-AACAAGTTTTTCATCGATAC 390 – Ga(oA) 340 – a(oB) Ga(i-2)

M17528

506³

Ga(i-1) M17527

630–AAARCAGTGRATCCACTT² 142-CHATYGTSAARCAGATGA² 503³

Ga(i-3) M20713 Ga(s) M12673

644-AGTCAGGCACGTTCATCACAC 329-AGCAGCTGCAGAAGGACAAG 268 – Ga(s-s) 336 – Ga(s-l) HPRT

X62085

587–CAAGGGCATATCCAACAACA 353–GTCAACGGGGGACATAAAAGT 254

b-ACTIN BCO63166

1146–ACTCCTGCTTGCTGATCCAC 939–CGTTGACATCCGTAAAGACC 227

1Primer names begin with a common name of the gene, followed by the Accession number used to design the primers;²nucleotide number for Ga(q) and Ga(11) – 997 and for Ga(12) – 1124;³the same length of all Ga(i) gene transcripts (503 bp) which are distinguished by later diges- tion with PstI enzyme according procedure described in Materials and Methods

Tab. 2. Parameters of PCR reaction

Ga(12,q,11) Ga(o) Ga(i) Ga(s) HPRT b-actin

Initial denaturation 94°C/5 min 94°C/5 min 94°C/5 min 94°C/5 min 94°C/5 min 94°C/5 min denaturation

annealing extension Number of cycles:

PFC Nac

94°C/1 min 64°C/1 min 72°C/1 min

26 cycles 22 cycles

94°C/1 min 59°C/1 min 72°C/1 min

28 cycles 28 cycles

94°C/1 min 48°C/1 min 72°C/1 min

28 cycles 28 cycles

94°C/1 min 58°C/1 min 72°C/1 min

23-28cycles 23 cycles

94°C/1 min 64°C/1 min 72°C/1 min

20 cycles 20 cycles

94°C/1 min 60°C/1 min 72°C/1 min

18 cycles 18 cycles Final extension 72°C/10 min 72°C/10 min 72°C/15 min 72°C/15 min 72°C/7 min 72°C/7 min

(5)

gel electrophoresis. The cDNA products of Ga(i1) (length 476 and 27 bp) and Ga(i2) (373 and 133 bp) were then quantified.

Agarose gel electrophoresis

For the assessment of Ga(12), Ga(q), Ga(11) and Ga(oA) levels, PCR products were electrophoresed in a non-denaturing 1.3% agarose gel (super-fine resolu- tion, SFR agarose; Amresco) containing 5 × 10^–4% ethidium bromide. A 10 µl volume of PCR product composed of PCR reaction solution (84% v/v) com- bined with (16% v/v) loading buffer (0.5 × Loading Dye in 50% sucrose, Fermentas) was pipetted into each well of the gel. In each gel, one lane was loaded with Gene Ruler 50 bp DNA (Fermentas) or PhiX174 DNA BsuRI (HaeIII) ladder. Electrophoresis was per- formed in 0.5 × TBE buffer (Amresco) at 75 V for 2.5 h.

PCR products were visualized using a CCD camera (Fuji Las 1000), and densitometric quantification of the fluorescence bands was carried out using Image Gauge 4.0 software (Fuji). Relative transcript levels of target genes were normalized to HPRT or b-actin.

Polyacrylamide gel electrophoresis

For the assessment of Ga(s) and Ga(i), the PCR and digestion products were electrophoresed in poly- acrylamide gel containing 0.5×TBE and 5% Acryl/

Bis (29:1) (Amresco). Band intensity was assessed by laser fluorometry using YOYO-3 (Molecular Probes, Eugene, OR, USA), an intercalating fluorescent dye, and an automated electrophoresis unit (Alf-Express II, Pharmacia, Uppsala, Sweden). Samples were pipetted into each well of the gel in a total loading volume of 4 µl, composed of 3 µl of PCR- or digestion-products combined with 1µl of loading buffer (50% sucrose;

1 µM YOYO-3; and 0.4 or 2 fmol of loading marker, the 100-bp DNA fragment, Alf-Express Sizer 100, Amersham Pharmacia Biotech, NJ, USA). In each gel, one lane was loaded with Gene Ruler 50 bp DNA Ladder (Fermentas). The gels were run at 100 mA, 500 V, and 25°C for 100 min. Areas under the peak of cDNA and loading marker were determined in an automated fashion using ALFwin Fragment Analyzer software (Pharmacia). The absolute fluorescence signal was recalculated as the ratio of cDNA to loading marker, and either HPRT or b-actin was used as a ref- erence gene.

Data analysis

All values are averages of four to eight rats ± the standard error of the mean (SEM). Statistical analysis was performed using Statistica10.0 software (StatSoft, Tulsa, OK, USA) using one-way analysis of variance (ANOVA) or two-way ANOVA where appropriate followed by Scheffe post-hoc test; p < 0.05 was con- sidered statistically significant.

Results

Morphine-induced conditioned place preference

While no differences in time spent in the white chamber were observed between the groups at the pretest (ANOVA, p = 0.28), the final score (mean ± SEM, in s) for rats conditioned with morphine was much longer (91.93 ± 19.49) compared to the control animals (4.37

± 16.20) [F (1, 14) = 11.94; p < 0.01].

Effects of morphine-induced CPP on mRNA expression of Ga subunits in the rat brain

The influence of morphine-induced CPP on the mRNA levels of Ga subunits of the main families of G protein was investigated in PFC and NAc by comparing the results obtained in CPP animals with those receiving morphine in home cages (NO-CPP animals).

Prefrontal cortex: Ga(i2), Ga(oA), Ga(s-l)mRNAs

The expression of mRNA for Ga(i2) was significantly decreased (by 58%, p < 0.05 vs. saline control) in the PFC of rats undergoing CPP (Fig. 1A) but remained unchanged in the animals receiving morphine in home cages (Fig. 1B). Neither CPP induced by morphine nor morphine alone affected the mRNA expression of Ga(oA) (103.1% ± 23.6 for CPP and 66.9% ± 12.4 for NO-CPP) and Ga(s-l) (95.3% ± 19.6 for CPP and 106.8% ± 19.9 for NO-CPP) vs. control (not shown).

Prefrontal cortex: Ga(q), Ga(11) and Ga(12) mRNAs Morphine treatment in the home cage induced significant increases (by approximately 50%) in mRNA lev-

(6)

els of all G proteins that are not associated with AC.

Although the CPP procedure rather did not change the effect of morphine on Ga(q) and Ga(11) it apparently inhibited its effect on Ga(12) (Fig. 2A, B). Two-way ANOVA revealed significant effect of morphine treat- ment on the expression of Ga(q) [F (1, 20) = 45.64, p < 0.001], Ga(11) [F (1, 20) = 25.14, p < 0.001] and Ga(12) [F (1, 20) = 16.04, p < 0.001] mRNAs. In case of Ga(12) expression, there was also significant effect of CPP procedure [F (1, 20) = 4.52, p < 0.05]

and morphine treatment × CPP procedure interaction [F (1, 20) = 4.52, p < 0.05].

Nucleus accumbens: Ga(oA), Ga(s-l) mRNAs

Changes in the expression of G protein mRNA in the NAc were observed only in rats that underwent the CPP procedure. Specifically, we observed a 30%

decrease in Ga(oA) [F (1 ,9) = 7.73, p < 0.05] (Fig. 3) and a 60% increase in Ga(s-l) [F (1, 24) = 3.42, p = 0.07] (Fig. 4) as a result of the CPP procedure. Rats that were given morphine in the home cage (the NO-CPP group) did not exhibit any changes in G protein mRNA levels after morphine treatment (Fig.

3B and 4B).

Fig. 2. Effect of morphine-induced CPP on the mRNA levels of Ga(12), Ga(q) and Ga(11) subunits in the pre- frontal cortex of rat brain. (A) CPP rats;

(B) NO-CPP rats; Data are expressed as a percent of control value (saline- treated rats), and bars represent the means ± SEM (n = 5–7). Inserts show the representative gel electrophoresis for the simultaneous detection of three Ga subunits. cDNA was prepared by reverse transcription 1.5 µg of total RNA. SAL – saline control; MOR – morphine group; Mw – marker of molecular weights. * p < 0.05; ** p < 0.01; *** p <

0.001 vs. SAL

Fig. 1. Effect of morphine-induced CPP on the mRNA level of Ga(i2) subunits in the prefrontal cortex of rat brain. (A) CPP rats. (B) NO-CPP rats.

Data are expressed as a percent of control (saline-treated rats), and bars represent the means ± SEM (n = 5–7 ).

cDNA was prepared by reverse transcription 2 µg of total RNA. SAL – saline control; MOR – morphine group.

* p < 0.05 vs. SAL

(7)

Nucleus accumbens: Ga(q), Ga(11) and Ga(12) mRNAs

There were also no significant changes in G protein mRNA levels in the NAc in rats showing morphine place preference (103.7% ± 10.0 for Ga(q); 103.7%

± 11.43 for Ga(11); and 92.9% ± 8.5 for Ga(12)) or in NO-CPP rats (78.24% ± 7.5 for Ga(q); 80.0%

± 10.1 for Ga(11); and 75.13% ± 6.83 for Ga(12)) vs.

the control group (n = 6 per group) (not shown).

Discussion

CPP has been frequently used for testing drug- addiction phenomena in preclinical studies because the majority of drugs abused by humans produce place conditioning [3, 37, 44]. In line with the earlier studies in rats [27], the conditioning procedure used in our experiment was highly effective and resulted in a significant prolongation of the time spent in the

Fig. 3. Effect of morphine-induced CPP on the mRNA levels of Ga(oA) subunits in the nucleus accumbens of rat brain. (A) CPP rats; (B) NO-CPP rats. Data are expressed as a percent of control (saline-treated rats), and bars represent the means ± SEM (n = 4–7). Inserts show the representative gel electrophoresis for Ga(oA) and b-actin. cDNA was prepared by re- verse transcription 0.6 µg of total RNA.

SAL – saline control; MOR – morphine group; Mw – marker of molecular weights. * p < 0.05 vs. SAL

Fig. 4. Effects of morphine-induced CPP on the mRNA levels of Ga(s-l) subunits in the nucleus accumbens of rat brain. (A) CPP rats; (B) NO-CPP rats. Data are expressed as a percent of control (saline-treated rats), and bars represent the means ± SEM (n = 6–8). cDNA was prepared from 0.6 µg of total RNA by reverse transcription.

SAL – saline control; MOR – morphine group. * p < 0.05 vs. SAL

(8)

morphine-associated compartment. Such a behavioral change implies the induction of adaptive alterations in signaling pathways [1] that are thought to involve molecular modifications (see, [28]). Despite the knowl- edge of neural circuitry and neurotransmitters implicated in cue-elicited drug craving [25], little is known about the molecular mechanisms by which environmental stimuli exert their motivational influence on morphine-craving behavior. This prompted us to in- vestigate possible changes in the mRNA expression of various subunits of G proteins (Ga(i), Ga(o), Ga(s), Ga(q), Ga(11), Ga(12)) in the NAc and PFC of rats exhibiting conditioned place preference to morphine.

Although changes in mRNA expression do not neces- sarily mirror the changes in protein levels, they are widely regarded as indices of alterations of physiological function (e.g., [8, 11, 45]). In accordance with this point of view, we sought to characterize changes in the mRNA expression of different Ga subunits to provide additional information regarding the signaling cascades involved in morphine-induced CPP.

Our experiments aimed at finding out how the rewarding effect of morphine influences its direct effect on G proteins, and revealed that differences between CPP- and NO-CPP-induced changes occur mainly in the G proteins involved in cyclic AMP (cAMP) signaling. The development of morphine-induced place preference was associated with decreases in the levels of Ga(i2) in PFC and Ga(oA) in NAc and increased expression of Ga(s) in NAc. Thus, while basal opioid receptor signaling and morphine action is mediated primarily by G(i/o) proteins (that inhibit AC/cAMP pathway), the development of place preference acti- vates (in a presently unknown mechanism) the non- opioid receptor coupled G(s) proteins, and their activation results in prevalence of stimulation of cAMP pathway.

Moreover, our data indicate that CPP seems to counteract the basic, pharmacological effects of morphine on Ga(12) (i.e., the morphine-induced increase in Ga in the PFC). On the other hand, in the PFC (but not in the NAc), the administration of morphine alone in- creased the mRNA of Ga(q) and Ga(11) and similar changes were observed after morphine-induced CPP.

The NAc has been shown to be involved in dopaminergic aspects of reward behavior [2], and the PFC has been implicated in the cognitive aspects of addiction, particularly in the formation of reward memories [10]. Both structures are also critical for Pavlovian conditioning [15].

The PFC is a collection of functionally specialized subregions responsible for cognitive and executive processes (see for review, [7]). The medial-PFC is the main target of mesocortical dopamine neurons and is also a part of the brain reward system. The fact that morphine injected into the PFC does not elicit CPP, but lesions of this area with quinolinic acid suffice to block the development of morphine-induced CPP implies that the medial-PFC is critical for learning the associations required to develop conditioned place preferences [38].

In the PFC of morphine-treated CPP and NO-CPP rats, we observed a significant increase in Ga(q) and Ga(11) mRNAs, suggesting that morphine admini- stration induces an up-regulation of the PKC pathway.

Interestingly, the up-regulation of Ga(q/11)-depen- dent PKC activity has been proposed to be involved in the development of sensitization [20], and PKC in- hibitors have been shown to block morphine-induced CPP [19]. The current data support our previous results indicating that chronic morphine leads to alterations in the expression of various G proteins [18]. In addition, we demonstrate (current data) that even small doses of morphine (1 mg/kg, 3 doses) are suffi- cient to trigger adaptation processes.

Although there is no evidence indicating that G(q/11) is coupled to ORs, it is plausible that these receptors may regulate PLC activity, the downstream ef- fector of Gq/11 proteins [35]. Because Gq/11 proteins are not coupled to ORs, the changes in Gq/11 mRNA expression observed in the current study may be secon- dary effects downstream of morphine-induced alterations of other receptors (e.g., noradrenergic or gluta- matergic receptors). Indeed, antagonists of mGluR5 were found to inhibit morphine-induced CPP [27], and the depletion of noradrenergic neurotransmission in PFC blocked morphine-induced CPP reinstatement [40]. It is important to note that the observed increase in Ga(q,11) mRNAs (current study) is not specifically involved in associative learning processes, as it was observed in both CPP and NO-CPP rats.

In contrast, the morphine-induced increase in the Ga(12) mRNA level in NO-CPP rats was absent in PFC of CPP rats. Although Ga(12) signals through a different intracellular pathway than Ga(q/11), these two pathways may cooperate, and in some situations their interaction is necessary for the induction of cellular plasticity (see [12]). The role of such an interaction in the central nervous system is not yet clear, nev- ertheless it might be important for neuronal plasticity.

(9)

Our results suggest that Ga(12) is somehow involved in the conditioned rewarding properties of morphine, but the specific receptor(s) involved in this signaling pathway has yet to be determined. It is possible that we do not observe an increase in Ga(12) mRNA in the morphine-induced CPP paradigm because the behavioral action (experiencing cues associated with rewarding effects of morphine) caused changes oppo- site to those exerted by morphine in animals that do not have the opportunity to seek reward.

Contrary to the effects described above, the changes observed in the Ga subunits that regulate the cAMP pathway were observed only in CPP rats. Here we found that the morphine-induced CPP decreased Ga(i) and Ga(o) mRNAs, the subunits that inhibit

AC activity and cAMP generation, and it increased Ga(s-l), the protein stimulating the AC/cAMP path- way. This suggests that seeking of morphine reward is accompanied by (or occurs as a result of) an enhancement of the cAMP pathway in various brain regions.

Our results corroborate the hypothesis that the increased activity of cAMP/PKA transduction pathway is an essential factor in morphine and psychostimulant dependence [22, 43]. In addition, our results suggest that this effect is specifically involved in the mechanism of learning to associate cues paired previously with morphine taking.

It is well known that Gi/o protein a subunits in the NAc play a crucial role in the reinforcing and addictive properties of opiates and psychostimulants because the

Fig. 5. Schematic representation of a switch in G protein subtype expression and changes in cellular signaling induced by morphine given to non-conditioned rats and those with developed conditioned place preference for morphine. Left panel: NO-CPP – Morphine injection unac- companied by environmental cues did not change the level of Ga subunits coupled with morphine receptors, therefore leaving the physiologi- cal signaling activity undisturbed. Right panel: CPP – Morphine paired with environmental cues decreased the level of the µ opioid receptor- coupled Ga(i/o) that inhibits the cyclic AMP generation in the cell. Additionally, the mRNA level of Ga(s) coupled with non-opioid receptors was elevated. In consequence, the cyclic AMP/PKA signaling is enhanced, facilitating induction of plastic changes. We conclude that the condi- tioned rewarding activity of morphine is specifically associated with the augmentation of the activity of cyclic AMP signaling pathway. Gai/o – G(i/o) protein, Gas – G(s) protein, AC – adenylyl cyclase, cAMP – cyclic AMP, PKA – protein kinase A. Note that only Gai/o coupled µ opioid re- ceptors bind morphine, and thus for development of morphine-induced CPP they must cooperate with non-opiate receptors

(10)

inhibition of these subunits with pertussis toxin increases heroin and cocaine self-administration [31].

The diminished expression of Ga(oA) reported here is consistent with immunostaining studies showing a sig- nificant reduction of Ga(i2) concentration in the NAc of human heroin users [16] and with data from animal models that revealed a decrease in Ga(i/o) protein lev- els in the NAc of morphine-treated rats [33].

In addition to decreasing the expression of Ga(oA) in the NAc, CPP was also shown to increase the level of Ga(s-l) mRNA. Ga(s-l) is one of the most com- mon splice variants of Ga(s) mRNA in the rat brain [24]. Because the product of Ga(s) is positively cou- pled to cAMP generation, one can assume that an enhancement of the cAMP pathway activity may result from the changes in relative G protein expression observed in our study.

Perhaps the most important finding in the present study is the demonstration that only in rats that have been trained for morphine-induced place preference, the expression of G proteins related to cAMP cascade was changed in the manner that would facilitate the cAMP signaling (Fig. 5). This observation implies that the increase in AC activity associated with opioid withdrawal and dependence may be specifically involved in the formation of memories connecting cues with morphine reward. Because morphine receptors are primarily coupled to Ga(i/o) proteins (although in some circumstances also to Ga(s)) [5], the observed regulation of Ga(o) and Ga(s) mRNA expression could be the direct conse- quence of µOR stimulation. However, although µOR mRNA, protein and ligand binding sites are abundant in NAc neurons [13], opiate-induced plasticity has not been observed [4, 36]. Rather, the changes reported here seem to be an indirect consequence of morphine inter- acting with dopamine D1 and D2 receptors, coupled to Gs and Gi/o, respectively, whose activation in the NAc is necessary for the acquisition of morphine-induced CPP [9]. Indeed, a negative correlation of D2 receptor levels in the NAc with the reinforcing activity of psychostimulants in humans [41] and alcohol in rodents [34] has been ob- served. Therefore, the diminished level of Ga(o) mRNA coupled to D2 receptors may suggest a similar regulation in morphine craving. Because the D1 receptor is directly involved in increasing PKA activity [30] and delta FosB induction in the NAc after morphine sensitization [17], the increase of Ga(s-l) mRNA may reflect changes of the D1 receptor signaling during drug craving.

In conclusion, the present study indicates that morphine-induced reward seeking, and not morphine alone, is accompanied by changes in the G proteins that control the generation of cAMP. Our data strongly corroborate previous reports that the cAMP pathway plays a crucial role in mediating the reward- related behavioral effects of opiates.

Acknowledgments:

This research was supported by the statutory funds of the Institute of Pharmacology, PAS and the State Committee for Scientific Research (KBN) grant PBZ No. 033/P05/2001, Warszawa, Poland.

We thank Dr. Adam Roman for consultation on statistical analysis of the data and Ms. Marta Kowalska for an excellent technical assistance. The linguistic assistance was provided by American Journal Experts (http://www.journalexperts.com), but we are entirely responsible for the scientific content of the paper.

References:

1.Beninger RJ, Gerdjikov T: The role of signaling mole- cules in reward-related incentive learning. Neurotox Res, 2004, 6, 91–104.

2.Berridge KC, Robinson TE: What is the role of dopamine in reward: hedonic impact, reward learning, or incentive salience? Brain Res Brain Res Rev, 1998, 28, 309–369.

3.Budzyñska B, Bia³a G: Effects of bupropion on the reinstatement of nicotine-induced conditioned place prefer- ence by drug priming in rats. Pharmacol Rep, 2011, 63, 362–371.

4.Buzas B, Rosenberger J, Cox BM: Mu and delta opioid receptor gene expression after chronic treatment with opioid agonist. Neuroreport, 1996, 7, 1505–1508.

5.Chakrabarti S, Regec A, Gintzler AR: Biochemical dem- onstration of mu-opioid receptor association with Gsa:

enhancement following morphine exposure. Brain Res Mol Brain Res, 2005, 135, 217–224.

6.Commons KG, Aicher SA, Kow LM, Pfaff DW: Pre- synaptic and postsynaptic relations of µ-opioid receptors to g-aminobutyric acid-immunoreactive and medullary- projecting periaqueductal gray neurons. J Comp Neurol, 2000, 419, 532–542.

7.Dalley JW, Cardinal RN, Robbins TW: Prefrontal executive and cognitive functions in rodents: neural and neuro- chemical substrates. Neurosci Biobehav Rev, 2004, 28, 771–784.

8.Escriba PV, Ozaita A, Garcia-Sevilla JA: Increased mRNA expression of a_2A-adrenoceptors, serotonin receptors and µ-opioid receptors in the brains of suicide vic- tims. Neuropsychopharmacology, 2004, 29, 1512–1521.

9.Fenu S, Spina L, Rivas E, Longoni R, Di Chiara G:

Morphine-conditioned single-trial place preference: role of nucleus accumbens shell dopamine receptors in acqui- sition, but not expression. Psychopharmacology (Berl), 2006, 187, 143–153.

(11)

10.Hyman SE, Malenka RC, Nestler EJ: Neural mechanisms of addiction: the role of reward-related learning and memory. Annu Rev Neurosci, 2006, 29, 565–598.

11.Kitanaka N, Kitanaka J, Hall FS, Tatsuta T, Morita Y, Takemura M, Wang XB et al.: Alterations in the levels of heterotrimeric G protein subunits induced by psychostimulants, opiates, barbiturates, and ethanol: Impli- cations for drug dependence, tolerance, and withdrawal.

Synapse, 2008, 62, 689–699.

12.Kurose H: Ga₁₂and Ga₁₃as key regulatory mediator in signal transduction. Life Sci, 2003, 74, 155–161.

13.Mansour A, Fox CA, Akil H, Watson SJ: Opioid- receptor mRNA expression in the rat CNS: anatomical and functional implications. Trends Neurosci, 1995, 18, 22–29.

14.Matthes HW, Maldonado R, Simonin F, Valverde O, Slowe S, Kitchen I, Befort K et al.: Loss of morphine- induced analgesia, reward effect and withdrawal symp- toms in mice lacking the mu-opioid-receptor gene. Na- ture, 1996, 383, 819–823.

15.McGinty VB, Grace AA: Selective activation of medial prefrontal-to-accumbens projection neurons by amygdala stimulation and Pavlovian conditioned stimuli. Cereb Cortex, 2008, 18, 1961–1972.

16.McLeman ER, Warsh JJ, Ang L, Li PP, Kalasinsky KS, Ross BM, Tong J et al.: The human nucleus accumbens is highly susceptible to G protein down-regulation by methamphetamine and heroin. J Neurochem, 2000, 74, 2120–2126.

17.Muller DL, Unterwald EM: D1 dopamine receptors modulate DFosB induction in rat striatum after intermit- tent morphine administration. J Pharmacol Exp Ther, 2005, 314, 148–154.

18.Nalepa I, Zelek-Molik A, Bielawski A, Roman A, Vetulani J: Does the presence of morphine counteract adaptive changes in expression of G-protein a subunits mRNA induced by chronic morphine treatment? Pharma- col Rep, 2007, 59, 34–45.

19.Narita M, Aoki T, Ozaki S, Yajima Y, Suzuki T: Involve- ment of protein kinase Cg isoform in morphine-induced reinforcing effects. Neuroscience, 2001, 103, 309–314.

20.Narita M, Mizuo K, Shibasaki M, Suzuki T: Up-regulation of the G_q/11aprotein and protein kinase C during the development of sensitization to morphine-induced hyperlo- comotion. Neuroscience, 2002, 111, 127–132.

21.Neer EJ: Heterotrimeric G proteins: organizers of trans- membrane signals. Cell, 1995, 80, 249–257.

22.Nestler EJ, Aghajanian GK: Molecular and cellular basis of addiction. Science, 1997, 278, 58–63.

23.New DC, Wong YH: Molecular mechanisms mediating the G protein-coupled receptor regulation of cell cycle progression. J Mol Signal, 2007, 2, 2.

24.Novotny J, Svoboda P: The long (G_sa-L) and short (G_sa-S) variants of the stimulatory guanine nucleotide- binding protein. Do they behave in an identical way?

J Mol Endocrinol, 1998, 20, 163–173.

25.O’Brien CP, Gardner EL: Critical assessment of how to study addiction and its treatment: human and non-human animal models. Pharmacol Ther, 2005, 108, 18–58.

26.Popik P, Danysz W: Inhibition of reinforcing effects of morphine and motivational aspects of naloxone-

precipitated opioid withdrawal by N-methyl-D-aspartate receptor antagonist, memantine. J Pharmacol Exp Ther, 1997, 280, 854–865.

27.Popik P, Wrobel M: Morphine conditioned reward is in- hibited by MPEP, the mGluR5 antagonist. Neuropharma- cology, 2002, 43, 1210–1217.

28.Przewlocki R: Opioid abuse and brain gene expression.

Eur J Pharmacol, 2004, 500, 331–349.

29.Sanak M, Kreiner G, Kowalska M, Nalepa I, Vetulani J:

Haloperidol treatment selectively affects expression of Ga_i3 subunit mRNA in specific regions of the rat brain.

Pol J Pharmacol, 1999, 51, 525–530.

30.Scheggi S, Crociani A, De Montis MG, Tagliamonte A, Gambarana C: Dopamine D₁receptor-dependent modifications in the dopamine and cAMP-regulated phos- phoprotein of M_r32 kDa phosphorylation pattern in stri- atal areas of morphine-sensitized rats. Neuroscience, 2009, 163, 627–639.

31.Self DW, Terwilliger RZ, Nestler EJ, Stein L: Inactiva- tion of Gi and G(o) proteins in nucleus accumbens re- duces both cocaine and heroin reinforcement. J Neurosci, 1994, 14, 6239–6247.

32.Tao R, Auerbach SB: Opioid receptor subtypes differen- tially modulate serotonin efflux in the rat central nervous system. J Pharmacol Exp Ther, 2002, 303, 549–556.

33.Terwilliger RZ, Beitner-Johnson D, Sevarino KA, Crain SM, Nestler EJ: A general role for adaptations in G- proteins and the cyclic AMP system in mediating the chronic actions of morphine and cocaine on neuronal function. Brain Res, 1991, 548, 100–110.

34.Thanos PK, Rivera SN, Weaver K, Grandy DK, Rubin- stein M, Umegaki H, Wang GJ et al.: Dopamine D2R DNA transfer in dopamine D2 receptor-deficient mice:

effects on ethanol drinking. Life Sci, 2005, 77, 130–139.

35.Tso PH, Wong YH: Molecular basis of opioid depend- ence: role of signal regulation by G-proteins. Clin Exp Pharmacol Physiol, 2003, 30, 307–316.

36.Turchan J, Przewlocka B, Toth G, Lason W, Borsodi A, Przewlocki R: The effect of repeated administration of morphine, cocaine and ethanol on mu and delta opioid receptor density in the nucleus accumbens and striatum of the rat. Neuroscience, 1999, 91, 971–977.

37.Tzschentke TM: Measuring reward with the conditioned place preference (CPP) paradigm: update of the last dec- ade. Addict Biol, 2007, 12, 227–462.

38.Tzschentke TM: The medial prefrontal cortex as a part of the brain reward system. Amino Acids, 2000, 19, 211–219.

39.Van Bockstaele EJ, Colago EE, Cheng P, Moriwaki A, Uhl GR, Pickel VM: Ultrastructural evidence for promi- nent distribution of the mu-opioid receptor at extrasynap- tic sites on noradrenergic dendrites in the rat nucleus lo- cus coeruleus. J Neurosci, 1996, 16, 5037–5048.

40.Ventura R, Alcaro A, Puglisi-Allegra S: Prefrontal cortical norepinephrine release is critical for morphine-induced reward, reinstatement and dopamine release in the nucleus accumbens. Cereb Cortex, 2005, 15, 1877–1886.

41.Volkow ND, Wang GJ, Fowler JS, Thanos PP, Logan J, Gatley SJ, Gifford A et al.: Brain DA D2 receptors pre- dict reinforcing effects of stimulants in humans: replica- tion study. Synapse, 2002, 46, 79–82.

(12)

42.Wettschureck N, Offermanns S: Mammalian G proteins and their cell type specific functions. Physiol Rev, 2005, 85, 1159–1204.

43.Williams JT, Christie MJ, Manzoni O: Cellular and syn- aptic adaptations mediating opioid dependence. Physiol Rev, 2001, 81, 299–343.

44.Wróbel M: Acquisition and expression of ethanol- induced conditioned place preference in mice is inhibited by naloxone. Pharmacol Rep, 2011, 63, 79–85.

45.Zelek-Molik A, Taracha E, Nawrat D, Bielawski A, Lehner M, P³aŸnik A, Nalepa I: Effects of morphine and methadone

treatment on mRNA expression of Ga(i) subunits in rat brains. Pharmacol Rep, 2010, 62, 1197–1203.

46.Zhu W, Pan ZZ: µ-Opioid-mediated inhibition of gluta- mate synaptic transmission in rat central amygdala neu- rons. Neuroscience, 2005, 133, 97–103.

Received: December 15, 2011; accepted: February 2, 2012.